Incidental Mutation 'R7294:Tbc1d22a'
ID566638
Institutional Source Beutler Lab
Gene Symbol Tbc1d22a
Ensembl Gene ENSMUSG00000051864
Gene NameTBC1 domain family, member 22a
SynonymsD15Ertd781e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7294 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location86214459-86498503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86311835 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 336 (Y336N)
Ref Sequence ENSEMBL: ENSMUSP00000065721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063414]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063414
AA Change: Y336N

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065721
Gene: ENSMUSG00000051864
AA Change: Y336N

DomainStartEndE-ValueType
Blast:TBC 25 94 5e-34 BLAST
low complexity region 118 133 N/A INTRINSIC
TBC 218 471 2.35e-43 SMART
Blast:TBC 476 515 1e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,673,582 Y1216* probably null Het
Abca17 G A 17: 24,321,009 T415M not run Het
Adam1a G T 5: 121,520,005 C408* probably null Het
Adamts9 G A 6: 92,894,289 T603M probably damaging Het
Amdhd1 T C 10: 93,534,439 E179G probably benign Het
Bcan T C 3: 87,995,524 T316A possibly damaging Het
Bpifb9a C T 2: 154,267,696 T504M probably damaging Het
C5ar1 T C 7: 16,249,025 I23M probably benign Het
Cd109 A T 9: 78,712,635 E1386D probably damaging Het
Cdcp1 C T 9: 123,177,921 C587Y probably benign Het
Cdh22 A C 2: 165,142,093 V413G possibly damaging Het
Col6a3 A T 1: 90,828,283 Y95N probably damaging Het
Dusp13 A G 14: 21,733,714 S178P possibly damaging Het
Fhod3 A G 18: 25,132,980 E1575G probably damaging Het
Gfpt2 C T 11: 49,818,608 R209* probably null Het
Gm12169 T A 11: 46,535,612 I182K probably benign Het
Heg1 T C 16: 33,726,489 S573P probably damaging Het
Hinfp A G 9: 44,299,270 C152R probably damaging Het
Hmgcs2 C T 3: 98,290,895 T38I probably benign Het
Jakmip1 T C 5: 37,117,460 F441L possibly damaging Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Krt15 T A 11: 100,132,022 I456F possibly damaging Het
Leprotl1 A T 8: 34,138,852 probably null Het
Muc4 A T 16: 32,756,461 T42S possibly damaging Het
Nat6 T G 9: 107,582,983 F26V possibly damaging Het
Nr1h5 T C 3: 102,945,262 T419A probably benign Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1259 A C 2: 89,943,724 Y130* probably null Het
Olfr549 T A 7: 102,554,953 I223N probably damaging Het
Pax6 T A 2: 105,684,901 C66* probably null Het
Pde10a A T 17: 8,757,021 N53Y probably benign Het
Pdgfra A G 5: 75,181,651 N711S probably benign Het
Rimkla A T 4: 119,468,466 S249T probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Scn3a A G 2: 65,472,341 S1254P probably damaging Het
Slc26a1 G T 5: 108,673,832 R80S possibly damaging Het
Slc2a4 T C 11: 69,945,399 D262G probably benign Het
Specc1 T A 11: 62,118,337 S226R probably benign Het
Srsf4 A G 4: 131,900,461 S289G unknown Het
Stil T C 4: 115,007,283 V127A probably benign Het
Syne1 A T 10: 5,097,483 probably null Het
Tbc1d8 C T 1: 39,406,762 G116E probably damaging Het
Thrb A G 14: 17,826,963 probably benign Het
Tln1 G T 4: 43,534,399 H2253Q probably benign Het
Tmem131 A C 1: 36,854,847 N158K possibly damaging Het
Toporsl A C 4: 52,611,903 T599P probably benign Het
Tpr C T 1: 150,403,887 R256C probably damaging Het
Triobp C T 15: 78,973,976 A1259V probably damaging Het
Zfp40 A G 17: 23,176,437 I392T possibly damaging Het
Other mutations in Tbc1d22a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Tbc1d22a APN 15 86301555 missense probably damaging 1.00
IGL01483:Tbc1d22a APN 15 86391203 missense probably benign 0.24
IGL02137:Tbc1d22a APN 15 86299669 missense probably benign 0.02
IGL02543:Tbc1d22a APN 15 86239171 missense probably benign 0.30
R0138:Tbc1d22a UTSW 15 86299684 missense probably damaging 1.00
R1168:Tbc1d22a UTSW 15 86292134 missense probably benign 0.01
R1294:Tbc1d22a UTSW 15 86496826 missense probably damaging 0.98
R1565:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1586:Tbc1d22a UTSW 15 86351651 splice site probably null
R1703:Tbc1d22a UTSW 15 86239215 missense probably benign 0.09
R1822:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1823:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1824:Tbc1d22a UTSW 15 86235569 missense possibly damaging 0.48
R1925:Tbc1d22a UTSW 15 86239149 missense probably damaging 1.00
R2014:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2015:Tbc1d22a UTSW 15 86299684 missense probably damaging 0.99
R2035:Tbc1d22a UTSW 15 86391065 splice site probably null
R4380:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4616:Tbc1d22a UTSW 15 86235685 missense probably damaging 1.00
R4690:Tbc1d22a UTSW 15 86311836 missense probably damaging 1.00
R4825:Tbc1d22a UTSW 15 86351734 missense probably damaging 1.00
R4883:Tbc1d22a UTSW 15 86496916 missense possibly damaging 0.91
R4920:Tbc1d22a UTSW 15 86311748 missense probably benign 0.20
R4979:Tbc1d22a UTSW 15 86391086 missense probably damaging 1.00
R5913:Tbc1d22a UTSW 15 86351728 missense probably damaging 0.98
R5916:Tbc1d22a UTSW 15 86214608 missense possibly damaging 0.57
R6360:Tbc1d22a UTSW 15 86214629 missense probably damaging 1.00
R6483:Tbc1d22a UTSW 15 86301567 missense possibly damaging 0.48
R7138:Tbc1d22a UTSW 15 86239155 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCTTAGTGTTGGAGACAGTGAG -3'
(R):5'- GGATGGATGGACTCTTTAGAGAAC -3'

Sequencing Primer
(F):5'- GTGTTGGAGACAGTGAGAAATATTG -3'
(R):5'- GGACTCTTTAGAGAACCCTGACTAG -3'
Posted On2019-06-26