Incidental Mutation 'R7353:Neurl1a'
ID570772
Institutional Source Beutler Lab
Gene Symbol Neurl1a
Ensembl Gene ENSMUSG00000006435
Gene Nameneuralized E3 ubiquitin protein ligase 1A
SynonymsNeur1, Rnf67, Neurl, Neu1, Nlz, 2410129E16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7353 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location47178820-47259440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47240660 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 213 (V213A)
Ref Sequence ENSEMBL: ENSMUSP00000107439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111807] [ENSMUST00000111808]
Predicted Effect probably damaging
Transcript: ENSMUST00000111807
AA Change: V196A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107438
Gene: ENSMUSG00000006435
AA Change: V196A

DomainStartEndE-ValueType
NEUZ 43 166 8.33e-66 SMART
Blast:NEUZ 186 213 1e-8 BLAST
low complexity region 241 253 N/A INTRINSIC
NEUZ 274 397 1.79e-56 SMART
low complexity region 440 456 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
RING 504 543 2.22e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111808
AA Change: V213A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107439
Gene: ENSMUSG00000006435
AA Change: V213A

DomainStartEndE-ValueType
NEUZ 60 183 8.33e-66 SMART
Blast:NEUZ 203 230 9e-9 BLAST
low complexity region 258 270 N/A INTRINSIC
NEUZ 291 414 1.79e-56 SMART
low complexity region 457 473 N/A INTRINSIC
low complexity region 486 499 N/A INTRINSIC
RING 521 560 2.22e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Depending on the targeted mutation, homozygotes show a spectrum of conflicting phenotypes ranging from axonemal and spermatid abnormalities, male sterility and deficient lactation, to just a specific olfactory discrimination defect and ethanol hypersensitivity on motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Emilin3 T A 2: 160,908,821 E336V probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Neurl1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03186:Neurl1a APN 19 47240477 missense probably damaging 0.99
R1403:Neurl1a UTSW 19 47253711 missense probably damaging 1.00
R1822:Neurl1a UTSW 19 47257459 missense probably benign 0.16
R3040:Neurl1a UTSW 19 47239831 missense probably benign 0.00
R3435:Neurl1a UTSW 19 47257525 missense probably damaging 1.00
R3767:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R3770:Neurl1a UTSW 19 47239889 missense probably damaging 1.00
R3884:Neurl1a UTSW 19 47253446 missense probably benign 0.30
R4539:Neurl1a UTSW 19 47256744 missense probably damaging 1.00
R5108:Neurl1a UTSW 19 47257635 missense probably damaging 1.00
R5644:Neurl1a UTSW 19 47179477 missense probably benign
R6167:Neurl1a UTSW 19 47239928 missense probably damaging 1.00
X0063:Neurl1a UTSW 19 47253674 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TTGCCTGAGGAGTTTGCCAAC -3'
(R):5'- AACTCAGAGAGCACCCTGAG -3'

Sequencing Primer
(F):5'- TGAGGAGTTTGCCAACGAGGG -3'
(R):5'- CCCACTTGCCAAAGCTGTG -3'
Posted On2019-09-13