Incidental Mutation 'R0629:Slc10a2'
ID57751
Institutional Source Beutler Lab
Gene Symbol Slc10a2
Ensembl Gene ENSMUSG00000023073
Gene Namesolute carrier family 10, member 2
SynonymsASBT
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0629 (G1)
Quality Score223
Status Validated
Chromosome8
Chromosomal Location5083219-5105351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5098562 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 128 (S128G)
Ref Sequence ENSEMBL: ENSMUSP00000023835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023835]
Predicted Effect probably benign
Transcript: ENSMUST00000023835
AA Change: S128G

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023835
Gene: ENSMUSG00000023073
AA Change: S128G

DomainStartEndE-ValueType
Pfam:SBF 39 220 1e-47 PFAM
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/bile acid cotransporter. This transporter is the primary mechanism for uptake of intestinal bile acids by apical cells in the distal ileum. Bile acids are the catabolic product of cholesterol metabolism, so this protein is also critical for cholesterol homeostasis. Mutations in this gene cause primary bile acid malabsorption (PBAM); muatations in this gene may also be associated with other diseases of the liver and intestines, such as familial hypertriglyceridemia (FHTG). [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially indistinguishable from wild-type in terms of survival, gross appearance and behavior. However, they do have defects in lipid absorption from the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Slc10a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc10a2 APN 8 5091668 missense probably damaging 0.96
IGL00504:Slc10a2 APN 8 5091667 missense probably benign 0.00
IGL00596:Slc10a2 APN 8 5091680 missense probably benign 0.00
IGL01472:Slc10a2 APN 8 5091652 missense probably damaging 1.00
IGL02679:Slc10a2 APN 8 5098499 missense probably damaging 1.00
gall UTSW 8 5091621 critical splice donor site probably null
R0560:Slc10a2 UTSW 8 5089092 missense probably benign 0.02
R0743:Slc10a2 UTSW 8 5089132 missense probably damaging 0.99
R0970:Slc10a2 UTSW 8 5105115 missense probably benign 0.00
R1033:Slc10a2 UTSW 8 5104889 missense probably damaging 0.99
R1557:Slc10a2 UTSW 8 5091755 missense probably damaging 1.00
R1808:Slc10a2 UTSW 8 5104856 missense probably damaging 0.96
R3620:Slc10a2 UTSW 8 5104909 missense probably damaging 0.99
R4084:Slc10a2 UTSW 8 5089126 missense possibly damaging 0.71
R4112:Slc10a2 UTSW 8 5105135 missense probably benign
R5693:Slc10a2 UTSW 8 5105128 missense probably damaging 1.00
R6294:Slc10a2 UTSW 8 5091621 critical splice donor site probably null
R6459:Slc10a2 UTSW 8 5098581 splice site probably null
R7442:Slc10a2 UTSW 8 5089086 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGCCTAATTCTCCTCAGGGCAGATG -3'
(R):5'- GAGATAACACCAAGTGCCAGTGACC -3'

Sequencing Primer
(F):5'- CTCCTCAGGGCAGATGATTAG -3'
(R):5'- GCTAGTTGAGTCTGATGCTCAC -3'
Posted On2013-07-11