Incidental Mutation 'R0662:Hormad1'
ID61875
Institutional Source Beutler Lab
Gene Symbol Hormad1
Ensembl Gene ENSMUSG00000028109
Gene NameHORMA domain containing 1
SynonymsNohma, 4921522K05Rik
MMRRC Submission 038847-MU
Accession Numbers

Genbank: NM_026489.2; Ensembl: ENSMUST00000107154, ENSMUST00000090797, ENSMUST00000029754, ENSMUST00000171191

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0662 (G1)
Quality Score136
Status Not validated
Chromosome3
Chromosomal Location95559677-95587671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95575599 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 132 (I132T)
Ref Sequence ENSEMBL: ENSMUSP00000102772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029754] [ENSMUST00000090797] [ENSMUST00000107154] [ENSMUST00000171191]
Predicted Effect probably benign
Transcript: ENSMUST00000029754
AA Change: I132T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029754
Gene: ENSMUSG00000028109
AA Change: I132T

DomainStartEndE-ValueType
Pfam:HORMA 24 221 4.7e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090797
AA Change: I132T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000088303
Gene: ENSMUSG00000028109
AA Change: I132T

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107154
AA Change: I132T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102772
Gene: ENSMUSG00000028109
AA Change: I132T

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171191
AA Change: I132T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127180
Gene: ENSMUSG00000028109
AA Change: I132T

DomainStartEndE-ValueType
Pfam:HORMA 23 221 5.4e-60 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HORMA domain-containing protein. HORMA domains are involved in chromatin binding and play a role in cell cycle regulation. The encoded protein may play a role in meiosis, and expression of this gene is a potential marker for cancer. A pseudogene of this gene is located on the long arm of chromosome 6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozgous mice are infertile because of meiosis arrest associated with impaired synaptonemal-complex formation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,938 S241P probably benign Het
Ankrd53 G T 6: 83,763,643 V83L probably damaging Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
C4b G A 17: 34,730,888 R1441C probably damaging Het
Cacng3 T C 7: 122,768,359 I154T probably damaging Het
Cand2 A G 6: 115,787,210 D315G probably benign Het
Celsr2 A T 3: 108,398,520 S2089R probably damaging Het
Chd9 A C 8: 90,977,676 K247Q probably damaging Het
Chil1 A C 1: 134,188,573 S263R probably damaging Het
Clec12b A C 6: 129,376,237 C262W probably damaging Het
Cpsf7 T C 19: 10,526,008 M1T probably null Het
Cul3 T C 1: 80,271,565 D597G probably damaging Het
Dcaf11 T C 14: 55,565,507 V251A possibly damaging Het
Eno2 A T 6: 124,763,811 F218I probably damaging Het
Frmd6 A T 12: 70,899,444 R549* probably null Het
Fyb2 G A 4: 104,995,698 S461N possibly damaging Het
Gm5709 A T 3: 59,606,743 noncoding transcript Het
Itga7 G T 10: 128,953,531 R981L probably damaging Het
Itgbl1 T A 14: 123,827,894 N153K probably damaging Het
Itih1 T C 14: 30,933,360 E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcna2 A T 3: 107,105,401 T433S probably benign Het
Map4k5 A G 12: 69,813,153 V673A probably damaging Het
Mmp27 T A 9: 7,577,650 V281E probably benign Het
Nr2c1 A T 10: 94,190,738 I492F probably damaging Het
Olfr131 A G 17: 38,082,933 I15T probably benign Het
Olfr292 A G 7: 86,694,630 Y58C possibly damaging Het
Olfr457 C T 6: 42,471,774 V135M possibly damaging Het
Olfr703 A T 7: 106,844,649 I13F probably benign Het
Olfr77 G C 9: 19,920,500 C97S probably damaging Het
Olfr862 T C 9: 19,883,952 M118V probably benign Het
Olfr911-ps1 T A 9: 38,524,026 M98K probably damaging Het
Pank3 T C 11: 35,778,650 M237T probably damaging Het
Plekhh1 A G 12: 79,078,993 T1268A probably benign Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Rhcg C T 7: 79,599,729 V310M probably damaging Het
Ryr1 A T 7: 29,100,189 D906E probably damaging Het
Sez6l A T 5: 112,473,422 L262Q probably damaging Het
Shprh G A 10: 11,186,847 V1233I probably damaging Het
Slc3a1 A G 17: 85,037,207 E267G possibly damaging Het
Slc5a5 T A 8: 70,883,875 T616S probably benign Het
St5 G T 7: 109,557,426 P39Q probably damaging Het
Syne3 T G 12: 104,961,510 E318A probably benign Het
Tecpr2 A G 12: 110,896,228 T25A probably benign Het
Ubxn1 T A 19: 8,875,197 probably null Het
Unc5b C A 10: 60,772,583 R616L possibly damaging Het
Ush2a A G 1: 188,351,093 T278A probably benign Het
Utp14b A G 1: 78,664,999 T205A probably damaging Het
Vmn1r219 T C 13: 23,163,453 S271P possibly damaging Het
Vmn2r76 C T 7: 86,230,370 V241M probably benign Het
Zbtb24 G A 10: 41,462,279 G429D probably damaging Het
Zdhhc2 T C 8: 40,447,098 S68P probably damaging Het
Zfp719 G A 7: 43,584,254 M32I possibly damaging Het
Zfp975 T C 7: 42,662,526 N221S probably benign Het
Other mutations in Hormad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Hormad1 APN 3 95578297 missense possibly damaging 0.49
IGL01686:Hormad1 APN 3 95578269 missense probably benign 0.02
IGL02023:Hormad1 APN 3 95578293 missense possibly damaging 0.91
B6584:Hormad1 UTSW 3 95570696 splice site probably benign
R0025:Hormad1 UTSW 3 95585125 unclassified probably benign
R0704:Hormad1 UTSW 3 95566686 critical splice donor site probably null
R1854:Hormad1 UTSW 3 95580006 missense probably benign 0.08
R2199:Hormad1 UTSW 3 95567722 critical splice donor site probably null
R2371:Hormad1 UTSW 3 95575599 missense probably benign 0.18
R2411:Hormad1 UTSW 3 95580015 missense probably benign 0.41
R3522:Hormad1 UTSW 3 95576285 missense probably benign 0.01
R4075:Hormad1 UTSW 3 95578203 missense possibly damaging 0.47
R4202:Hormad1 UTSW 3 95585198 missense probably benign 0.00
R4535:Hormad1 UTSW 3 95585141 missense probably benign 0.00
R4536:Hormad1 UTSW 3 95585141 missense probably benign 0.00
R4844:Hormad1 UTSW 3 95570931 missense probably damaging 0.98
R4903:Hormad1 UTSW 3 95585220 splice site probably null
R4964:Hormad1 UTSW 3 95585220 splice site probably null
R5135:Hormad1 UTSW 3 95585220 unclassified probably benign
R5208:Hormad1 UTSW 3 95578107 missense possibly damaging 0.46
R5372:Hormad1 UTSW 3 95576424 missense probably damaging 1.00
R5825:Hormad1 UTSW 3 95562559 missense probably damaging 0.97
R5895:Hormad1 UTSW 3 95559733 critical splice donor site probably null
R6124:Hormad1 UTSW 3 95576302 missense probably benign
R6453:Hormad1 UTSW 3 95578257 missense probably benign 0.02
X0025:Hormad1 UTSW 3 95581567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCCACTCTGCTGAGGTGTGACTC -3'
(R):5'- TGCTCCATTTTGAAAGCTTGTCTGAGG -3'

Sequencing Primer
(F):5'- TGAGCACTTGAAACTCCAGTAG -3'
(R):5'- gggagaggtgataaaggaagg -3'
Posted On2013-07-30