Incidental Mutation 'R0710:Kif1c'
ID62704
Institutional Source Beutler Lab
Gene Symbol Kif1c
Ensembl Gene ENSMUSG00000020821
Gene Namekinesin family member 1C
SynonymsB430105J22Rik, D11Bwg1349e, Orch3, N-3 kinsin
MMRRC Submission 038893-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0710 (G1)
Quality Score85
Status Not validated
Chromosome11
Chromosomal Location70700548-70731964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70726497 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 874 (T874A)
Ref Sequence ENSEMBL: ENSMUSP00000123242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072187] [ENSMUST00000094499] [ENSMUST00000102554] [ENSMUST00000137119]
Predicted Effect probably benign
Transcript: ENSMUST00000072187
AA Change: T886A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072048
Gene: ENSMUSG00000020821
AA Change: T886A

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 673 N/A INTRINSIC
coiled coil region 842 883 N/A INTRINSIC
low complexity region 955 975 N/A INTRINSIC
low complexity region 1009 1055 N/A INTRINSIC
low complexity region 1072 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094499
AA Change: T874A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092075
Gene: ENSMUSG00000020821
AA Change: T874A

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102554
AA Change: T874A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099614
Gene: ENSMUSG00000020821
AA Change: T874A

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137119
AA Change: T874A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123242
Gene: ENSMUSG00000020821
AA Change: T874A

DomainStartEndE-ValueType
KISc 3 356 6.18e-175 SMART
low complexity region 402 418 N/A INTRINSIC
FHA 522 575 1.45e-2 SMART
low complexity region 607 622 N/A INTRINSIC
coiled coil region 634 671 N/A INTRINSIC
coiled coil region 830 871 N/A INTRINSIC
low complexity region 943 963 N/A INTRINSIC
low complexity region 997 1043 N/A INTRINSIC
low complexity region 1060 1088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. Mutations in this gene are a cause of spastic ataxia 2, autosomal recessive. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and overtly normal and display normal motor-dependent retrograde Golgi apparatus-to-endoplasmic reticulum transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Celsr2 A G 3: 108,412,712 V928A probably benign Het
Fam60a A G 6: 148,933,000 probably null Het
Farp1 C T 14: 121,237,143 T256M probably damaging Het
Fbxl3 G T 14: 103,089,315 H162Q probably damaging Het
Glra3 C T 8: 56,125,364 probably benign Het
Gpatch8 A G 11: 102,481,933 S260P unknown Het
Hectd4 G A 5: 121,336,628 V2771I probably benign Het
Hgf C A 5: 16,566,763 C129* probably null Het
Hmg20a G A 9: 56,474,670 D77N possibly damaging Het
Iqch A T 9: 63,525,136 S287T probably benign Het
Kcnj11 T C 7: 46,099,125 Y258C probably benign Het
Mlc1 G T 15: 88,977,864 Q50K possibly damaging Het
Mtor T C 4: 148,464,391 S544P possibly damaging Het
Mypop A T 7: 19,000,560 probably null Het
Poli A T 18: 70,522,890 probably null Het
Rasa3 C A 8: 13,583,830 V478L probably damaging Het
Scn3a A T 2: 65,469,046 M1372K probably damaging Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tnpo3 T C 6: 29,586,075 D172G possibly damaging Het
Tulp2 T A 7: 45,520,808 V301D possibly damaging Het
Ubr2 G A 17: 46,938,681 R1582W probably damaging Het
Ubr3 T C 2: 69,952,837 S706P probably damaging Het
Vmn1r171 C A 7: 23,633,001 S205Y probably damaging Het
Wnk4 G A 11: 101,274,106 A754T probably benign Het
Zfp282 C T 6: 47,880,384 R184W probably damaging Het
Other mutations in Kif1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Kif1c APN 11 70724134 splice site probably null
IGL00817:Kif1c APN 11 70705253 missense probably benign 0.25
IGL00849:Kif1c APN 11 70706127 missense probably damaging 1.00
IGL01988:Kif1c APN 11 70704936 missense probably damaging 1.00
IGL02683:Kif1c APN 11 70726452 missense possibly damaging 0.85
IGL03024:Kif1c APN 11 70705189 missense probably damaging 1.00
R0570:Kif1c UTSW 11 70704465 missense probably damaging 0.96
R0647:Kif1c UTSW 11 70726141 missense probably damaging 1.00
R1112:Kif1c UTSW 11 70724815 splice site probably null
R1199:Kif1c UTSW 11 70708601 missense possibly damaging 0.69
R1514:Kif1c UTSW 11 70705729 missense probably damaging 1.00
R1660:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1661:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1666:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1669:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1707:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1708:Kif1c UTSW 11 70728397 missense probably damaging 0.99
R1835:Kif1c UTSW 11 70708971 missense probably damaging 0.99
R1861:Kif1c UTSW 11 70703342 missense probably damaging 1.00
R2870:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2870:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2871:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2871:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2872:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2872:Kif1c UTSW 11 70724081 missense probably damaging 0.99
R2927:Kif1c UTSW 11 70726314 missense probably benign
R3720:Kif1c UTSW 11 70703771 missense possibly damaging 0.94
R4809:Kif1c UTSW 11 70726357 missense probably benign 0.10
R4914:Kif1c UTSW 11 70708855 missense probably damaging 0.99
R5642:Kif1c UTSW 11 70708447 missense probably benign 0.14
R5788:Kif1c UTSW 11 70708828 missense probably damaging 1.00
R5861:Kif1c UTSW 11 70703795 missense probably damaging 1.00
R6918:Kif1c UTSW 11 70706987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCTGGAGATGCCTGGAGAG -3'
(R):5'- TGCACAATCTACTGTCAGTGTTGTTCTG -3'

Sequencing Primer
(F):5'- GCCAGGGATGTCTGGGATAC -3'
(R):5'- TACGCCTTCTCAAAGGACAGAG -3'
Posted On2013-07-30