Incidental Mutation 'R0005:Olfr974'
ID63933
Institutional Source Beutler Lab
Gene Symbol Olfr974
Ensembl Gene ENSMUSG00000051493
Gene Nameolfactory receptor 974
SynonymsGA_x6K02T2PVTD-33640290-33641222, MOR171-1
MMRRC Submission 038301-MU
Accession Numbers

Genbank: NM_147107

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0005 (G1)
Quality Score91
Status Validated
Chromosome9
Chromosomal Location39937501-39945170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39942956 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 232 (D232G)
Ref Sequence ENSEMBL: ENSMUSP00000149630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062833] [ENSMUST00000213246]
Predicted Effect probably benign
Transcript: ENSMUST00000062833
AA Change: D232G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062985
Gene: ENSMUSG00000051493
AA Change: D232G

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.6e-52 PFAM
Pfam:7tm_1 41 290 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213246
AA Change: D232G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Olfr974
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr974 APN 9 39942680 missense probably benign 0.08
IGL01638:Olfr974 APN 9 39942520 missense probably benign 0.03
IGL02826:Olfr974 APN 9 39942958 missense probably damaging 1.00
IGL03136:Olfr974 APN 9 39943036 missense probably damaging 1.00
H2330:Olfr974 UTSW 9 39942920 missense probably damaging 1.00
R0106:Olfr974 UTSW 9 39942823 frame shift probably null
R1769:Olfr974 UTSW 9 39942955 missense probably benign 0.43
R1870:Olfr974 UTSW 9 39942821 missense probably damaging 0.99
R4416:Olfr974 UTSW 9 39942428 missense probably damaging 1.00
R4860:Olfr974 UTSW 9 39942504 missense probably benign 0.04
R4860:Olfr974 UTSW 9 39942504 missense probably benign 0.04
R5105:Olfr974 UTSW 9 39942398 missense probably benign 0.19
R5273:Olfr974 UTSW 9 39942557 missense probably benign
R6520:Olfr974 UTSW 9 39942362 missense possibly damaging 0.90
R7203:Olfr974 UTSW 9 39942509 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTTACGTTGCCATCTGCAACC -3'
(R):5'- AGAACAGCCCACTATTCAGAGCCTT -3'

Sequencing Primer
(F):5'- TTCGGGGCTACAGTTCATACAAG -3'
(R):5'- AGAGCCTTTTTAATGGCTTCTTTGAC -3'
Posted On2013-07-30