Incidental Mutation 'R0747:Slc36a2'
ID70195
Institutional Source Beutler Lab
Gene Symbol Slc36a2
Ensembl Gene ENSMUSG00000020264
Gene Namesolute carrier family 36 (proton/amino acid symporter), member 2
SynonymsPAT2, A530067G19Rik, Tramd1
MMRRC Submission 038928-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R0747 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location55158470-55185077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55169859 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 242 (I242F)
Ref Sequence ENSEMBL: ENSMUSP00000045613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039305]
Predicted Effect probably benign
Transcript: ENSMUST00000039305
AA Change: I242F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045613
Gene: ENSMUSG00000020264
AA Change: I242F

DomainStartEndE-ValueType
Pfam:Aa_trans 47 458 3.6e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125560
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pH-dependent proton-coupled amino acid transporter that belongs to the amino acid auxin permease 1 protein family. The encoded protein primarily transports small amino acids such as glycine, alanine and proline. Mutations in this gene are associated with iminoglycinuria and hyperglycinuria. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik T A 14: 12,287,287 M16K probably benign Het
Adam19 A T 11: 46,118,495 probably null Het
Anks4b C T 7: 120,182,163 A139V probably damaging Het
Arf1 G A 11: 59,212,635 R149C probably benign Het
Axl A T 7: 25,764,059 C598S possibly damaging Het
B3gnt2 T C 11: 22,836,316 I291V possibly damaging Het
Ccdc158 T A 5: 92,633,297 H883L probably benign Het
Col6a3 A G 1: 90,802,653 S1644P probably damaging Het
Cspg4 T C 9: 56,890,280 S1343P probably damaging Het
D430041D05Rik G T 2: 104,230,306 H1414Q probably damaging Het
Dnah5 C G 15: 28,444,186 I4043M probably damaging Het
Dnah5 T A 15: 28,444,187 C4044S possibly damaging Het
Dpep3 C T 8: 105,977,386 A267T probably benign Het
Dync1h1 A C 12: 110,612,411 H106P probably benign Het
Dync1h1 A C 12: 110,629,284 E1466A probably damaging Het
Fggy T C 4: 95,812,100 probably benign Het
Frmd6 A G 12: 70,864,056 T5A probably benign Het
Gnb5 G A 9: 75,311,470 V26I probably benign Het
Hephl1 A T 9: 15,054,001 probably benign Het
Hmmr C T 11: 40,721,745 probably benign Het
Hpn A T 7: 31,099,546 F356Y probably damaging Het
Iqgap3 T C 3: 88,107,503 probably benign Het
Ism2 A G 12: 87,285,398 probably benign Het
Kansl1 T A 11: 104,342,976 M754L probably benign Het
Kcnc4 A T 3: 107,448,154 I326N probably damaging Het
Lcn6 G A 2: 25,677,172 V62M probably damaging Het
Lrp1b A T 2: 40,870,341 C2858S probably damaging Het
Lyn G A 4: 3,745,638 probably benign Het
Mov10 T A 3: 104,802,496 H358L probably benign Het
Notch1 A G 2: 26,472,140 V60A unknown Het
Olfr720 C T 14: 14,175,429 A218T probably benign Het
Pgap2 C A 7: 102,237,136 Y176* probably null Het
Pglyrp1 A G 7: 18,890,275 Q161R possibly damaging Het
Plod3 A G 5: 136,988,195 N66S probably benign Het
Psmc3 A G 2: 91,054,300 E18G probably benign Het
Psme3 T G 11: 101,317,046 M9R probably benign Het
Rapgef4 A G 2: 72,223,073 N428S possibly damaging Het
Rbp3 A G 14: 33,956,278 I728V possibly damaging Het
Sall4 A T 2: 168,754,966 H651Q probably damaging Het
Skint3 T A 4: 112,253,905 Y76N probably damaging Het
Slc13a4 T C 6: 35,278,328 T342A probably damaging Het
Slc25a1 G T 16: 17,926,220 T239K probably damaging Het
Tekt2 G A 4: 126,323,760 Q171* probably null Het
Tet2 T G 3: 133,467,470 H1677P possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trcg1 C T 9: 57,241,921 P259S probably benign Het
Ttn A C 2: 76,710,598 S25688A probably damaging Het
Vmn2r117 T A 17: 23,475,503 R457* probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Other mutations in Slc36a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Slc36a2 APN 11 55162788 nonsense probably null
IGL01152:Slc36a2 APN 11 55169847 splice site probably benign
IGL01545:Slc36a2 APN 11 55184807 splice site probably null
IGL01835:Slc36a2 APN 11 55162733 missense probably benign 0.01
IGL02935:Slc36a2 APN 11 55170028 missense possibly damaging 0.67
R0025:Slc36a2 UTSW 11 55162795 missense probably damaging 1.00
R0025:Slc36a2 UTSW 11 55162795 missense probably damaging 1.00
R0067:Slc36a2 UTSW 11 55162640 splice site probably benign
R0417:Slc36a2 UTSW 11 55181544 critical splice donor site probably null
R0927:Slc36a2 UTSW 11 55181585 missense probably damaging 0.98
R1186:Slc36a2 UTSW 11 55164231 critical splice donor site probably null
R1673:Slc36a2 UTSW 11 55184913 missense possibly damaging 0.86
R1677:Slc36a2 UTSW 11 55184909 missense probably benign
R2109:Slc36a2 UTSW 11 55181555 missense probably damaging 1.00
R4037:Slc36a2 UTSW 11 55164275 missense probably benign 0.10
R4945:Slc36a2 UTSW 11 55174694 missense probably benign 0.10
R5108:Slc36a2 UTSW 11 55159388 missense probably damaging 0.96
R6534:Slc36a2 UTSW 11 55184867 missense probably benign 0.00
R7188:Slc36a2 UTSW 11 55162657 missense possibly damaging 0.95
R7219:Slc36a2 UTSW 11 55168918 missense probably benign 0.14
X0063:Slc36a2 UTSW 11 55168828 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACAGGTACTGGCAAACGGTTTAC -3'
(R):5'- CAAGAACGAGACGGTAGTTCTGACG -3'

Sequencing Primer
(F):5'- CTGGCAAACGGTTTACTAATGG -3'
(R):5'- GTAGTTCTGACGCCCACC -3'
Posted On2013-09-30