Incidental Mutation 'R0749:Atxn2l'
ID70249
Institutional Source Beutler Lab
Gene Symbol Atxn2l
Ensembl Gene ENSMUSG00000032637
Gene Nameataxin 2-like
SynonymsA2lp, A2D, A2RP, A2LG
MMRRC Submission 038929-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R0749 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126491708-126503437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126500837 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 109 (S109T)
Ref Sequence ENSEMBL: ENSMUSP00000137108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040202] [ENSMUST00000166682] [ENSMUST00000167759] [ENSMUST00000179818] [ENSMUST00000206577]
Predicted Effect probably benign
Transcript: ENSMUST00000040202
AA Change: S166T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000035415
Gene: ENSMUSG00000032637
AA Change: S166T

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
low complexity region 56 73 N/A INTRINSIC
Pfam:SM-ATX 119 189 8.5e-21 PFAM
LsmAD 262 331 1.95e-28 SMART
low complexity region 357 382 N/A INTRINSIC
low complexity region 450 470 N/A INTRINSIC
Pfam:PAM2 657 672 5.6e-8 PFAM
low complexity region 681 697 N/A INTRINSIC
low complexity region 764 787 N/A INTRINSIC
low complexity region 920 947 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166682
AA Change: S46T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125881
Gene: ENSMUSG00000032637
AA Change: S46T

DomainStartEndE-ValueType
Pfam:SM-ATX 1 69 1.6e-21 PFAM
LsmAD 142 211 1.95e-28 SMART
low complexity region 237 262 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
Pfam:PAM2 537 553 4.3e-8 PFAM
low complexity region 561 577 N/A INTRINSIC
low complexity region 644 667 N/A INTRINSIC
low complexity region 800 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167759
AA Change: S80T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000132959
Gene: ENSMUSG00000032637
AA Change: S80T

DomainStartEndE-ValueType
Pfam:SM-ATX 33 103 8.1e-23 PFAM
LsmAD 176 245 1.95e-28 SMART
low complexity region 271 296 N/A INTRINSIC
low complexity region 364 384 N/A INTRINSIC
Pfam:PAM2 571 587 4.2e-8 PFAM
low complexity region 595 611 N/A INTRINSIC
low complexity region 678 701 N/A INTRINSIC
low complexity region 834 861 N/A INTRINSIC
low complexity region 893 905 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
low complexity region 944 960 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179818
AA Change: S109T

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000137108
Gene: ENSMUSG00000032637
AA Change: S109T

DomainStartEndE-ValueType
Pfam:SM-ATX 62 132 4.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206577
AA Change: S166T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ataxin type 2 related protein of unknown function. This protein is a member of the spinocerebellar ataxia (SCAs) family, which is associated with a complex group of neurodegenerative disorders. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aprt A T 8: 122,575,410 Y105N probably damaging Het
Bbs9 T C 9: 22,575,201 probably null Het
Bmp4 T C 14: 46,384,613 E158G probably damaging Het
Btn2a2 T C 13: 23,478,398 *418W probably null Het
Cpt1c A G 7: 44,962,826 Y494H probably damaging Het
Cyp3a16 T A 5: 145,456,177 probably null Het
Dpy19l1 T A 9: 24,462,584 H270L probably benign Het
Fdxr A G 11: 115,276,845 S15P probably benign Het
Gm8688 T G 8: 99,664,520 noncoding transcript Het
Golph3l G A 3: 95,607,949 R134Q probably damaging Het
Hmgxb4 A G 8: 75,000,937 T183A probably damaging Het
Krt2 T G 15: 101,817,663 S147R unknown Het
Lipn T C 19: 34,076,979 S206P probably damaging Het
Mcpt2 A G 14: 56,043,679 probably null Het
Metap2 T C 10: 93,879,567 E133G probably benign Het
Nuak1 T C 10: 84,374,784 Y480C probably damaging Het
Oma1 C T 4: 103,325,299 Q300* probably null Het
Pcnt T C 10: 76,381,364 E2161G probably damaging Het
Pkdrej G T 15: 85,818,074 D1220E probably benign Het
Ptdss1 T A 13: 66,987,850 C390* probably null Het
Sars A C 3: 108,428,266 F389V possibly damaging Het
Sec31b C T 19: 44,524,506 V515M probably damaging Het
Syt3 A G 7: 44,399,147 E587G probably benign Het
Tjp2 T C 19: 24,122,272 E417G possibly damaging Het
Tmem63b A G 17: 45,666,115 F442S possibly damaging Het
Togaram1 A G 12: 64,982,698 D965G possibly damaging Het
Zmynd10 T C 9: 107,548,683 V72A probably damaging Het
Other mutations in Atxn2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Atxn2l APN 7 126498288 missense possibly damaging 0.94
IGL00507:Atxn2l APN 7 126496584 missense possibly damaging 0.51
IGL00846:Atxn2l APN 7 126499178 missense probably damaging 1.00
IGL01813:Atxn2l APN 7 126500253 missense probably damaging 1.00
R0005:Atxn2l UTSW 7 126498274 missense probably damaging 1.00
R0267:Atxn2l UTSW 7 126493207 missense probably damaging 1.00
R0608:Atxn2l UTSW 7 126501416 splice site probably null
R0831:Atxn2l UTSW 7 126499160 missense probably damaging 1.00
R0881:Atxn2l UTSW 7 126496596 missense probably damaging 1.00
R1022:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1024:Atxn2l UTSW 7 126497294 missense probably benign 0.01
R1081:Atxn2l UTSW 7 126494212 missense probably damaging 1.00
R1132:Atxn2l UTSW 7 126494248 small deletion probably benign
R1489:Atxn2l UTSW 7 126496467 missense probably damaging 1.00
R1919:Atxn2l UTSW 7 126493168 missense probably damaging 0.99
R2062:Atxn2l UTSW 7 126495866 missense probably damaging 1.00
R2170:Atxn2l UTSW 7 126503239 start gained probably benign
R3719:Atxn2l UTSW 7 126498130 missense probably damaging 1.00
R3861:Atxn2l UTSW 7 126501951 critical splice donor site probably null
R5061:Atxn2l UTSW 7 126500203 missense probably damaging 1.00
R6022:Atxn2l UTSW 7 126496435 critical splice donor site probably null
R6075:Atxn2l UTSW 7 126492517 missense possibly damaging 0.70
R6131:Atxn2l UTSW 7 126503165 unclassified probably benign
R6460:Atxn2l UTSW 7 126494248 small deletion probably benign
R6552:Atxn2l UTSW 7 126493821 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TCTCGTCAGCTTCTTGACACAACAG -3'
(R):5'- GGCACCACTTACGAGGGCATTTTC -3'

Sequencing Primer
(F):5'- acaacagttcagagcgatacc -3'
(R):5'- CGAGGGCATTTTCAAGACTC -3'
Posted On2013-09-30