Incidental Mutation 'R0833:Grm8'
ID77632
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Nameglutamate receptor, metabotropic 8
SynonymsmGluR8, Gprc1h
MMRRC Submission 039012-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R0833 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location27275119-28135178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27363179 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 779 (E779V)
Ref Sequence ENSEMBL: ENSMUSP00000110979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324]
Predicted Effect probably damaging
Transcript: ENSMUST00000090512
AA Change: E779V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: E779V

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115323
AA Change: E779V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: E779V

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115324
AA Change: E779V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: E779V

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (97/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,165,069 L41P probably damaging Het
3110082I17Rik A G 5: 139,364,120 V58A possibly damaging Het
4932415M13Rik A T 17: 53,724,346 noncoding transcript Het
Aldh1a7 C T 19: 20,702,243 V390M probably damaging Het
Alg14 A G 3: 121,298,610 H34R probably damaging Het
Ankrd27 A G 7: 35,608,347 N337S probably damaging Het
Apoa2 T A 1: 171,225,379 probably benign Het
Arl2 T G 19: 6,136,022 K126T probably damaging Het
Ascc3 T C 10: 50,845,666 W2072R probably benign Het
Astl T C 2: 127,342,419 F21L probably benign Het
Asxl3 A G 18: 22,516,040 D362G probably damaging Het
Bdp1 A T 13: 100,035,825 H2094Q probably benign Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cbwd1 A G 19: 24,940,839 probably benign Het
Ccdc144b A G 3: 36,020,213 probably benign Het
Ccdc85a T A 11: 28,583,296 I83F probably damaging Het
Ccnt2 T A 1: 127,802,394 M336K probably benign Het
Cd226 A C 18: 89,207,020 probably benign Het
Ces1f A T 8: 93,270,024 S214T probably damaging Het
Clip1 T C 5: 123,630,721 D605G probably benign Het
Col26a1 A G 5: 136,765,300 probably null Het
Crtc1 A G 8: 70,393,013 V306A probably benign Het
D130043K22Rik G A 13: 24,863,580 probably benign Het
D17H6S53E A T 17: 35,127,409 probably null Het
D17Wsu92e A T 17: 27,786,138 S148R probably damaging Het
Dnah11 G A 12: 118,196,662 A111V probably benign Het
Dyrk2 T C 10: 118,861,122 H77R probably benign Het
E330017A01Rik G A 16: 58,635,523 S129L probably damaging Het
Epha3 A G 16: 63,603,519 probably benign Het
Epn2 T C 11: 61,519,491 N611S probably benign Het
Erich6 A C 3: 58,618,944 probably benign Het
Fam217b T C 2: 178,420,989 S249P probably benign Het
Fam219b A G 9: 57,538,016 probably benign Het
Fryl A T 5: 73,089,081 probably benign Het
Gm12800 G A 4: 101,910,097 C181Y probably damaging Het
Gm13089 A T 4: 143,698,486 M129K probably benign Het
Gm14496 T C 2: 181,996,266 W378R probably damaging Het
Gm5155 C A 7: 17,904,981 A301E possibly damaging Het
Gm8674 A T 13: 49,904,575 noncoding transcript Het
Grap T A 11: 61,660,239 D32E possibly damaging Het
Grk2 C A 19: 4,289,357 L428F probably damaging Het
Hipk1 A G 3: 103,754,296 S670P probably damaging Het
Itgae A T 11: 73,129,206 M845L probably benign Het
Itih1 A T 14: 30,941,555 V164E probably damaging Het
Itpka T A 2: 119,750,831 N448K probably damaging Het
Jak3 A C 8: 71,683,978 N643T probably damaging Het
Lrfn5 A C 12: 61,839,668 T81P probably damaging Het
Lrrc45 T A 11: 120,718,193 probably null Het
March6 T C 15: 31,480,291 Y562C probably benign Het
Mcrs1 T C 15: 99,243,449 probably benign Het
Meis1 G A 11: 18,881,767 H424Y possibly damaging Het
Mst1r G A 9: 107,913,167 V660I probably benign Het
Mst1r A G 9: 107,914,776 N837S probably benign Het
Mthfd2l T C 5: 90,946,942 V90A probably damaging Het
Mtnr1a A T 8: 45,087,937 I312F probably benign Het
Olfr1513 T C 14: 52,349,378 I223V probably benign Het
Olfr578 C A 7: 102,984,836 L109F possibly damaging Het
Olfr875 T C 9: 37,773,076 V139A probably benign Het
Otog C T 7: 46,269,362 T954I possibly damaging Het
Pdcd6 A G 13: 74,316,324 probably benign Het
Phlpp2 A G 8: 109,937,106 T926A probably damaging Het
Plec GGCAGCAG GGCAGCAGCAG 15: 76,181,907 probably benign Het
Plekha5 T A 6: 140,589,634 probably benign Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Rab27b T C 18: 69,987,041 probably benign Het
Rapsn T C 2: 91,036,808 Y152H probably damaging Het
Rasd1 A T 11: 59,964,553 F85I probably damaging Het
Rgs1 A T 1: 144,247,933 S85T probably damaging Het
Samd9l T C 6: 3,372,725 E1512G possibly damaging Het
Sgsm1 C T 5: 113,279,184 A127T probably benign Het
Shc1 A G 3: 89,422,969 D70G probably damaging Het
Slc26a1 T A 5: 108,673,523 T167S probably benign Het
Slc26a7 A T 4: 14,593,873 Y81N probably damaging Het
Slc2a12 T C 10: 22,702,016 probably benign Het
Slc30a7 T A 3: 115,990,140 probably null Het
Slc44a5 T C 3: 154,265,474 S654P probably damaging Het
Stard9 T G 2: 120,696,999 S1246A possibly damaging Het
Stxbp5 A T 10: 9,865,099 S116R probably damaging Het
Syvn1 C T 19: 6,052,453 P517L probably benign Het
Tas2r105 T C 6: 131,687,430 I12V probably benign Het
Tas2r121 A G 6: 132,700,362 S216P probably damaging Het
Tcof1 T C 18: 60,845,832 D48G probably damaging Het
Tgm3 C T 2: 130,026,682 probably benign Het
Tle2 T C 10: 81,588,947 F667L probably damaging Het
Tnfaip3 C A 10: 19,002,949 A704S probably benign Het
Trabd2b A G 4: 114,580,322 Q232R probably benign Het
Ttc28 T A 5: 111,231,081 I1144N probably damaging Het
Ucp3 T A 7: 100,479,541 C25* probably null Het
Ugt3a2 A G 15: 9,370,150 D460G probably damaging Het
Urb1 T C 16: 90,795,448 D308G possibly damaging Het
Ush1g G T 11: 115,318,868 R167S possibly damaging Het
Vav3 A G 3: 109,647,679 N81S possibly damaging Het
Vmn2r108 A T 17: 20,471,459 D267E probably benign Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27363801 missense probably damaging 1.00
IGL01412:Grm8 APN 6 27762461 missense probably damaging 1.00
IGL02329:Grm8 APN 6 27363116 missense probably damaging 1.00
IGL02342:Grm8 APN 6 27363804 missense probably benign 0.00
IGL02584:Grm8 APN 6 27762439 missense probably benign 0.35
IGL03040:Grm8 APN 6 28126123 start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27363263 missense probably damaging 1.00
IGL03139:Grm8 APN 6 27618650 missense probably damaging 1.00
IGL03287:Grm8 APN 6 27760255 missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27762390 missense probably damaging 0.99
R0266:Grm8 UTSW 6 27285896 missense probably damaging 1.00
R0347:Grm8 UTSW 6 27981222 missense probably benign 0.37
R0580:Grm8 UTSW 6 27761371 splice site probably benign
R0698:Grm8 UTSW 6 27363914 missense probably damaging 1.00
R1301:Grm8 UTSW 6 27981201 missense possibly damaging 0.94
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1471:Grm8 UTSW 6 27363309 missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28125853 missense probably benign 0.01
R1638:Grm8 UTSW 6 28125883 nonsense probably null
R1763:Grm8 UTSW 6 27285867 missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28125895 missense probably damaging 1.00
R1902:Grm8 UTSW 6 27429482 missense probably damaging 1.00
R1916:Grm8 UTSW 6 27363584 missense probably benign 0.01
R2257:Grm8 UTSW 6 27760225 missense probably damaging 0.98
R2351:Grm8 UTSW 6 28126119 missense possibly damaging 0.66
R2396:Grm8 UTSW 6 27761242 missense probably damaging 0.98
R3801:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3802:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27761229 nonsense probably null
R3844:Grm8 UTSW 6 27429508 missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27981230 missense probably damaging 1.00
R4077:Grm8 UTSW 6 27760209 missense probably benign 0.01
R4395:Grm8 UTSW 6 27429432 missense probably damaging 0.98
R4436:Grm8 UTSW 6 27761238 missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27761296 missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27762419 missense probably damaging 1.00
R5677:Grm8 UTSW 6 27761204 critical splice donor site probably null
R5983:Grm8 UTSW 6 27760221 missense probably benign 0.03
R5990:Grm8 UTSW 6 27363624 missense probably damaging 1.00
R6365:Grm8 UTSW 6 27363227 missense probably damaging 1.00
R6454:Grm8 UTSW 6 27363776 missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27363191 missense probably damaging 1.00
R6960:Grm8 UTSW 6 27981282 missense probably damaging 0.98
R7194:Grm8 UTSW 6 27618487 missense probably benign 0.01
R7259:Grm8 UTSW 6 27760176 missense probably null 0.99
R7305:Grm8 UTSW 6 27761355 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CATGCAATCGTGTTACTGGAGGGG -3'
(R):5'- GTCACAGCACCTAAGTTCATCAGCC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- CGTACAGCTCCTTGGAGTG -3'
Posted On2013-10-16