Incidental Mutation 'R0928:Zer1'
ID80600
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Namezyg-11 related, cell cycle regulator
SynonymsC230075L19Rik, Zyg11bl
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R0928 (G1)
Quality Score133
Status Not validated
Chromosome2
Chromosomal Location30097283-30124585 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 30101763 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000044751] [ENSMUST00000113677] [ENSMUST00000113677]
Predicted Effect probably null
Transcript: ENSMUST00000044751
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000044751
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000113677
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000113677
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154231
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,582 D745G possibly damaging Het
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 30108220 critical splice donor site probably null
IGL01630:Zer1 APN 2 30101831 missense probably damaging 1.00
IGL02126:Zer1 APN 2 30104916 missense probably benign 0.10
IGL02338:Zer1 APN 2 30113393 missense probably damaging 1.00
IGL02817:Zer1 APN 2 30103394 missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 30101120 missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 30103543 missense probably benign 0.01
R0390:Zer1 UTSW 2 30108213 splice site probably benign
R0506:Zer1 UTSW 2 30101807 missense probably damaging 1.00
R0606:Zer1 UTSW 2 30104797 splice site probably benign
R1167:Zer1 UTSW 2 30108246 missense probably benign 0.00
R1819:Zer1 UTSW 2 30110218 missense probably benign 0.18
R2040:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2041:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2042:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2092:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2168:Zer1 UTSW 2 30104875 missense probably damaging 1.00
R2243:Zer1 UTSW 2 30101127 missense probably damaging 0.99
R2254:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2255:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2311:Zer1 UTSW 2 30101822 missense probably damaging 0.99
R2993:Zer1 UTSW 2 30101897 missense probably damaging 1.00
R3010:Zer1 UTSW 2 30113285 missense probably benign 0.13
R3731:Zer1 UTSW 2 30110911 missense probably benign 0.44
R4038:Zer1 UTSW 2 30107523 missense probably damaging 1.00
R5241:Zer1 UTSW 2 30104970 missense probably damaging 1.00
R5433:Zer1 UTSW 2 30100986 intron probably benign
R5443:Zer1 UTSW 2 30110996 missense probably damaging 1.00
R5524:Zer1 UTSW 2 30104854 missense probably damaging 1.00
R5936:Zer1 UTSW 2 30107667 missense probably damaging 0.97
R5999:Zer1 UTSW 2 30104997 missense probably damaging 1.00
R6598:Zer1 UTSW 2 30113274 missense probably damaging 1.00
R6965:Zer1 UTSW 2 30101047 missense possibly damaging 0.87
R7030:Zer1 UTSW 2 30111021 missense probably benign 0.00
R7190:Zer1 UTSW 2 30103432 missense probably damaging 1.00
R7218:Zer1 UTSW 2 30105012 missense probably damaging 1.00
R7252:Zer1 UTSW 2 30101892 missense probably damaging 0.99
R7383:Zer1 UTSW 2 30111241 missense probably damaging 1.00
R7417:Zer1 UTSW 2 30102822 missense probably damaging 1.00
R7459:Zer1 UTSW 2 30113325 missense probably damaging 1.00
R7463:Zer1 UTSW 2 30113437 start gained probably benign
R7477:Zer1 UTSW 2 30107976 missense probably null 0.34
X0026:Zer1 UTSW 2 30104895 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTTACCATACACAGCGTGGCAG -3'
(R):5'- GCCGACGGCATTGAGGTTTCTTAC -3'

Sequencing Primer
(F):5'- TATGTAACATGCATAAGAGACAGGC -3'
(R):5'- GCATTGAGGTTTCTTACAACGC -3'
Posted On2013-11-07