Incidental Mutation 'R1132:Vmn1r39'
ID94700
Institutional Source Beutler Lab
Gene Symbol Vmn1r39
Ensembl Gene ENSMUSG00000093755
Gene Namevomeronasal 1 receptor 39
SynonymsGm5993
MMRRC Submission 039205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1132 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location66803297-66810609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66804444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 260 (V260I)
Ref Sequence ENSEMBL: ENSMUSP00000154432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089918] [ENSMUST00000226217] [ENSMUST00000226783] [ENSMUST00000227285] [ENSMUST00000227555] [ENSMUST00000228008] [ENSMUST00000228651] [ENSMUST00000228862] [ENSMUST00000228919]
Predicted Effect probably benign
Transcript: ENSMUST00000089918
AA Change: V297I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087364
Gene: ENSMUSG00000093755
AA Change: V297I

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226217
AA Change: V297I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226783
AA Change: V297I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227285
AA Change: V260I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227555
AA Change: V297I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228008
AA Change: V260I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228651
AA Change: V260I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228862
AA Change: V297I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228919
AA Change: V260I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apba1 T C 19: 23,917,553 V451A possibly damaging Het
Atxn2l CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 7: 126,494,248 probably benign Het
C3 C T 17: 57,207,531 probably null Het
Car9 G T 4: 43,512,439 probably null Het
Cd163 G T 6: 124,309,096 G202* probably null Het
Cdk8 A G 5: 146,299,815 T347A probably benign Het
Cep170 C A 1: 176,750,037 R1257L probably damaging Het
Cib1 A G 7: 80,228,030 F168S probably damaging Het
Cntnap5c G A 17: 58,294,356 G833D probably damaging Het
Dhx37 A T 5: 125,421,039 I702N probably damaging Het
Dnah3 T C 7: 119,939,004 K3586R possibly damaging Het
Fbxo31 ACGGCGCGGCG ACGGCGCGGCGCGGCG 8: 121,552,276 probably null Het
Fbxo31 CGCGG CGCGGAGCGG 8: 121,552,280 probably null Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Gaa T C 11: 119,285,059 S953P probably damaging Het
Inpp5j T C 11: 3,502,305 E315G possibly damaging Het
Itsn2 T C 12: 4,658,464 Y840H probably damaging Het
Kif1a T C 1: 93,056,021 E653G probably damaging Het
Loxhd1 T C 18: 77,429,943 V1829A possibly damaging Het
Myh8 C T 11: 67,297,131 Q910* probably null Het
Olfr101 T C 17: 37,299,532 R297G probably benign Het
Olfr115 G T 17: 37,610,442 T103K possibly damaging Het
Olfr298 A T 7: 86,489,217 F111L probably benign Het
Olfr699 A T 7: 106,790,551 I150N possibly damaging Het
Prdm4 A G 10: 85,899,281 S666P probably damaging Het
Rad50 T C 11: 53,694,961 K331E possibly damaging Het
Rbbp6 A G 7: 123,000,113 probably benign Het
Selenbp1 C G 3: 94,937,333 I100M probably benign Het
Skint6 A G 4: 112,898,099 probably null Het
Stac3 T C 10: 127,507,259 S208P probably benign Het
Tfap2a T C 13: 40,721,391 probably null Het
Trhde T C 10: 114,412,478 K939E possibly damaging Het
Vmn1r22 T C 6: 57,900,841 I50M probably benign Het
Zdhhc25 T C 15: 88,600,723 L87P probably damaging Het
Zfp202 T C 9: 40,211,022 L360P probably benign Het
Other mutations in Vmn1r39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Vmn1r39 APN 6 66804962 missense probably benign 0.05
R0189:Vmn1r39 UTSW 6 66805197 missense probably benign 0.10
R1803:Vmn1r39 UTSW 6 66804911 missense probably benign 0.00
R1839:Vmn1r39 UTSW 6 66805233 critical splice acceptor site probably null
R2966:Vmn1r39 UTSW 6 66804731 missense possibly damaging 0.94
R3747:Vmn1r39 UTSW 6 66804870 missense probably benign 0.03
R3748:Vmn1r39 UTSW 6 66804870 missense probably benign 0.03
R3756:Vmn1r39 UTSW 6 66804879 missense probably damaging 0.97
R3905:Vmn1r39 UTSW 6 66804495 nonsense probably null
R3912:Vmn1r39 UTSW 6 66805141 missense probably benign
R4226:Vmn1r39 UTSW 6 66804719 missense possibly damaging 0.78
R4426:Vmn1r39 UTSW 6 66805361 unclassified probably null
R5493:Vmn1r39 UTSW 6 66804770 missense probably damaging 0.97
R6498:Vmn1r39 UTSW 6 66804857 missense probably damaging 1.00
R6944:Vmn1r39 UTSW 6 66805221 start codon destroyed probably null 0.00
Predicted Primers PCR Primer
(F):5'- CCAGAGCAATCGGGGCAGGA -3'
(R):5'- CTGAGAAAAGGGCCACCCAGAC -3'

Sequencing Primer
(F):5'- tggggaagcagggaggg -3'
(R):5'- AGACCATCTTGCTGCTGG -3'
Posted On2014-01-05