Mutagenetix > Incidental Mutation

Incidental Mutation 'R1122:Adgrb1'

95769

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

B830018M07Rik, Bai1

MMRRC Submission

039195-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1122 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74388045-74461314 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 74419534 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 792 (R792S)

Ref Sequence

ENSEMBL: ENSMUSP00000046097 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000186360] [ENSMUST00000187485]

AlphaFold

Q3UHD1

Predicted Effect

probably damaging
Transcript: ENSMUST00000042035
AA Change: R792S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: R792S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186360
AA Change: R792S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: R792S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187485

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189200

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acadvl	G	A	11: 69,902,203 (GRCm39)	L469F	probably damaging	Het
Aif1	G	A	17: 35,391,127 (GRCm39)	P44L	probably benign	Het
Arhgap15	A	T	2: 44,032,307 (GRCm39)	H297L	probably benign	Het
Chtf18	T	C	17: 25,943,597 (GRCm39)	E333G	probably damaging	Het
Cyb5a	A	G	18: 84,895,964 (GRCm39)	T77A	possibly damaging	Het
Entrep1	T	C	19: 23,952,756 (GRCm39)	E518G	probably damaging	Het
Exosc10	T	C	4: 148,650,821 (GRCm39)	W456R	possibly damaging	Het
Fhip2a	A	T	19: 57,370,733 (GRCm39)	T551S	probably benign	Het
Gad2	A	T	2: 22,513,463 (GRCm39)	Q31L	possibly damaging	Het
Gm9637	T	A	14: 19,401,879 (GRCm38)		noncoding transcript	Het
Itgav	A	G	2: 83,622,283 (GRCm39)	T622A	probably benign	Het
Kifc5b	T	A	17: 27,143,035 (GRCm39)	V269E	probably benign	Het
Lrrc15	T	C	16: 30,092,719 (GRCm39)	N207D	probably damaging	Het
Map2k5	A	G	9: 63,170,445 (GRCm39)	V291A	probably damaging	Het
Mrc1	G	A	2: 14,266,147 (GRCm39)		probably null	Het
Nckap1	C	T	2: 80,348,286 (GRCm39)	S889N	probably benign	Het
Or12d12	T	A	17: 37,611,019 (GRCm39)	Q98L	probably damaging	Het
Or1o2	T	A	17: 37,542,934 (GRCm39)	D109V	probably damaging	Het
Pdzd2	A	G	15: 12,457,981 (GRCm39)	V294A	probably benign	Het
Rem1	G	A	2: 152,476,455 (GRCm39)	V238M	probably damaging	Het
Rnf220	C	T	4: 117,135,277 (GRCm39)	G171S	probably benign	Het
Slc6a4	T	C	11: 76,918,012 (GRCm39)	S585P	possibly damaging	Het
Slc7a8	T	C	14: 54,961,564 (GRCm39)	E528G	probably benign	Het
Slco4c1	A	G	1: 96,756,561 (GRCm39)	I587T	possibly damaging	Het
Syt4	T	A	18: 31,573,255 (GRCm39)	H420L	probably damaging	Het
Tec	T	C	5: 72,936,792 (GRCm39)	K236E	probably damaging	Het
Ttn	A	G	2: 76,545,676 (GRCm39)	V32549A	probably damaging	Het
Uqcc4	T	C	17: 25,403,846 (GRCm39)	I62T	probably benign	Het
Wdfy3	T	C	5: 102,030,832 (GRCm39)	H2299R	possibly damaging	Het
Zfp729b	A	G	13: 67,743,403 (GRCm39)	V64A	possibly damaging	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74,458,684 (GRCm39)	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74,420,206 (GRCm39)	splice site	probably benign
IGL01874:Adgrb1	APN	15	74,413,423 (GRCm39)	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74,413,424 (GRCm39)	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74,401,631 (GRCm39)	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74,412,326 (GRCm39)	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74,445,961 (GRCm39)	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74,458,654 (GRCm39)	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74,460,143 (GRCm39)	splice site	probably benign
IGL02678:Adgrb1	APN	15	74,410,177 (GRCm39)	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74,419,471 (GRCm39)	missense	probably damaging	0.98
Bunting	UTSW	15	74,415,550 (GRCm39)	missense	probably null	0.94
BB005:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
BB015:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
PIT4520001:Adgrb1	UTSW	15	74,413,508 (GRCm39)	missense	probably damaging	0.99
R0193:Adgrb1	UTSW	15	74,444,005 (GRCm39)	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74,458,656 (GRCm39)	missense	probably benign
R0267:Adgrb1	UTSW	15	74,401,238 (GRCm39)	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74,458,998 (GRCm39)	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74,415,198 (GRCm39)	missense	probably damaging	0.97
R0533:Adgrb1	UTSW	15	74,413,408 (GRCm39)	missense	probably damaging	1.00
R0635:Adgrb1	UTSW	15	74,412,741 (GRCm39)	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74,420,398 (GRCm39)	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74,452,466 (GRCm39)	missense	probably damaging	1.00
R1295:Adgrb1	UTSW	15	74,421,888 (GRCm39)	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74,452,466 (GRCm39)	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74,459,956 (GRCm39)	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74,401,192 (GRCm39)	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74,413,676 (GRCm39)	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74,401,389 (GRCm39)	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74,452,435 (GRCm39)	nonsense	probably null
R1895:Adgrb1	UTSW	15	74,412,314 (GRCm39)	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74,411,726 (GRCm39)	splice site	probably benign
R2114:Adgrb1	UTSW	15	74,412,411 (GRCm39)	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74,401,757 (GRCm39)	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74,419,553 (GRCm39)	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74,416,864 (GRCm39)	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74,460,157 (GRCm39)	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74,454,792 (GRCm39)	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74,415,511 (GRCm39)	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74,449,302 (GRCm39)	unclassified	probably benign
R4634:Adgrb1	UTSW	15	74,456,278 (GRCm39)	utr 3 prime	probably benign
R4683:Adgrb1	UTSW	15	74,459,963 (GRCm39)	missense	probably damaging	1.00
R4742:Adgrb1	UTSW	15	74,401,328 (GRCm39)	nonsense	probably null
R4760:Adgrb1	UTSW	15	74,443,312 (GRCm39)	missense	probably damaging	1.00
R4794:Adgrb1	UTSW	15	74,459,978 (GRCm39)	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74,458,871 (GRCm39)	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74,444,011 (GRCm39)	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74,401,664 (GRCm39)	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74,415,550 (GRCm39)	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74,449,348 (GRCm39)	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74,421,876 (GRCm39)	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74,413,423 (GRCm39)	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74,410,219 (GRCm39)	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74,412,292 (GRCm39)	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74,412,292 (GRCm39)	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74,412,308 (GRCm39)	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74,459,992 (GRCm39)	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74,401,210 (GRCm39)	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74,421,873 (GRCm39)	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74,401,750 (GRCm39)	missense	probably damaging	0.97
R7015:Adgrb1	UTSW	15	74,445,959 (GRCm39)	missense	probably damaging	1.00
R7061:Adgrb1	UTSW	15	74,441,730 (GRCm39)	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74,441,797 (GRCm39)	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74,441,733 (GRCm39)	missense	probably benign
R7283:Adgrb1	UTSW	15	74,452,512 (GRCm39)	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74,411,094 (GRCm39)	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74,420,418 (GRCm39)	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74,415,487 (GRCm39)	missense	possibly damaging	0.95
R7928:Adgrb1	UTSW	15	74,410,170 (GRCm39)	missense	probably damaging	1.00
R8152:Adgrb1	UTSW	15	74,416,849 (GRCm39)	missense	probably damaging	0.98
R8152:Adgrb1	UTSW	15	74,413,460 (GRCm39)	missense	probably benign	0.00
R8198:Adgrb1	UTSW	15	74,411,094 (GRCm39)	missense	probably damaging	0.99
R8485:Adgrb1	UTSW	15	74,420,153 (GRCm39)	missense	probably damaging	1.00
R8528:Adgrb1	UTSW	15	74,447,700 (GRCm39)	missense	possibly damaging	0.51
R8534:Adgrb1	UTSW	15	74,415,357 (GRCm39)	missense	probably damaging	0.97
R8865:Adgrb1	UTSW	15	74,415,507 (GRCm39)	missense	possibly damaging	0.75
R9044:Adgrb1	UTSW	15	74,441,748 (GRCm39)	missense	possibly damaging	0.95
R9098:Adgrb1	UTSW	15	74,415,189 (GRCm39)	missense	probably damaging	1.00
R9157:Adgrb1	UTSW	15	74,411,624 (GRCm39)	missense	probably damaging	0.98
R9166:Adgrb1	UTSW	15	74,420,475 (GRCm39)	missense	probably benign	0.00
R9313:Adgrb1	UTSW	15	74,411,624 (GRCm39)	missense	probably damaging	0.98
R9445:Adgrb1	UTSW	15	74,435,807 (GRCm39)	critical splice acceptor site	probably benign
Z1177:Adgrb1	UTSW	15	74,419,532 (GRCm39)	missense	probably damaging	0.99
Z1177:Adgrb1	UTSW	15	74,413,525 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGCACCAAAGCCTACTGCC -3'
(R):5'- GTTGCTGAGTGATCCATCCAACCC -3'

Sequencing Primer
(F):5'- AAAGCCTACTGCCTCGGTC -3'
(R):5'- TCCCTGTCACTGGAGACAATG -3'

Posted On

2014-01-05