Incidental Mutation 'R1110:Acp2'
ID96554
Institutional Source Beutler Lab
Gene Symbol Acp2
Ensembl Gene ENSMUSG00000002103
Gene Nameacid phosphatase 2, lysosomal
SynonymsAcp-2, LAP
MMRRC Submission 039183-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.403) question?
Stock #R1110 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91202885-91214098 bp(+) (GRCm38)
Type of Mutationunclassified (2376 bp from exon)
DNA Base Change (assembly) A to G at 91208422 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002172] [ENSMUST00000028696] [ENSMUST00000111352] [ENSMUST00000150403] [ENSMUST00000155418]
Predicted Effect probably benign
Transcript: ENSMUST00000002172
AA Change: D375G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002172
Gene: ENSMUSG00000002103
AA Change: D375G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 54 330 1.5e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028696
SMART Domains Protein: ENSMUSP00000028696
Gene: ENSMUSG00000002109

DomainStartEndE-ValueType
low complexity region 48 69 N/A INTRINSIC
WD40 100 140 1.48e-2 SMART
WD40 144 185 7.92e1 SMART
WD40 187 229 7.36e1 SMART
WD40 231 271 3.14e-6 SMART
WD40 278 316 3.55e-5 SMART
Blast:WD40 379 419 1e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111352
SMART Domains Protein: ENSMUSP00000106984
Gene: ENSMUSG00000002109

DomainStartEndE-ValueType
WD40 8 49 7.92e1 SMART
WD40 51 93 7.36e1 SMART
WD40 95 135 3.14e-6 SMART
WD40 142 180 3.55e-5 SMART
Blast:WD40 243 283 3e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135927
Predicted Effect probably null
Transcript: ENSMUST00000150403
SMART Domains Protein: ENSMUSP00000119144
Gene: ENSMUSG00000002103

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 32 159 4e-35 PFAM
Pfam:His_Phos_2 147 297 5.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152277
Predicted Effect probably null
Transcript: ENSMUST00000155418
SMART Domains Protein: ENSMUSP00000116030
Gene: ENSMUSG00000002103

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:His_Phos_2 32 166 4e-33 PFAM
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of lysosomal acid phosphatase (LAP). LAP is chemically and genetically distinct from red cell acid phosphatase. The encoded protein belongs to a family of distinct isoenzymes which hydrolyze orthophosphoric monoesters to alcohol and phosphate. LAP-deficiencies in mice cause multiple defects including bone structure alterations, lysosomal storage defects in the kidneys and central nervous system, and an increased tendency towards seizures. An enzymatically-inactive allele of LAP in mice exhibited a more severe phenotype than the null allele, and defects included cerebellum abnormalities, growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutation of this gene result in skeletal defects and a small percentage of mutant animals exhibit tonic-clonic seizures. Mice with a missense mutation (Gly244Glu) are growth retarded and exhibit a disrupted cerebellum cytoarchitecture, an abnormal hair shaft, and skin malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 T A 4: 155,905,399 probably null Het
Akap13 T G 7: 75,611,377 S447A possibly damaging Het
Alk G A 17: 71,984,745 probably benign Het
Arhgef39 T C 4: 43,496,834 T327A probably benign Het
Cdan1 G A 2: 120,720,602 A1103V probably damaging Het
Cdh18 A G 15: 23,474,317 T758A probably benign Het
Cdk17 T A 10: 93,239,033 Y3* probably null Het
Cdon T C 9: 35,456,437 probably benign Het
Cntn3 T A 6: 102,245,158 N460I probably benign Het
Cntrl T A 2: 35,160,627 C985S possibly damaging Het
Col6a2 T C 10: 76,607,740 E497G probably benign Het
Crybg1 A G 10: 43,999,093 M673T possibly damaging Het
Cyp2u1 A G 3: 131,293,609 I441T possibly damaging Het
Disp2 T C 2: 118,790,439 S551P probably damaging Het
Dock2 A T 11: 34,256,535 F1354I possibly damaging Het
Dstyk A G 1: 132,453,325 probably benign Het
Dzip1 T C 14: 118,889,305 N527S probably benign Het
Eomes A G 9: 118,484,599 I571V probably benign Het
Fam26e T G 10: 34,096,017 I141L probably benign Het
Fbxl13 T C 5: 21,484,036 D758G probably benign Het
Frem1 T C 4: 82,950,320 S1457G probably damaging Het
Gabbr2 C T 4: 46,718,838 C613Y probably damaging Het
Gm906 A T 13: 50,248,260 D83E possibly damaging Het
Gm9755 A T 8: 67,515,058 noncoding transcript Het
Hnrnpul2 A G 19: 8,826,746 R570G probably damaging Het
Igdcc4 A G 9: 65,126,926 H674R possibly damaging Het
Kdm5d T A Y: 910,539 L250H probably damaging Het
Kif1a T C 1: 93,023,453 probably benign Het
Kmt2c T C 5: 25,314,362 N2250S probably benign Het
Kmt2e C T 5: 23,502,655 H1739Y probably damaging Het
Lmtk3 T A 7: 45,795,003 probably benign Het
Lpin3 A G 2: 160,894,079 D93G probably benign Het
Myh10 T C 11: 68,791,850 probably benign Het
Myom2 G A 8: 15,122,413 E1171K probably benign Het
Ncoa6 A T 2: 155,411,520 probably benign Het
Nup160 A G 2: 90,733,219 probably benign Het
Oit3 G A 10: 59,428,194 R373C probably damaging Het
Olfml2a A T 2: 38,959,753 I494L probably damaging Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Olfr824 A G 10: 130,126,653 Y135H probably damaging Het
Parp6 G T 9: 59,649,564 C584F probably damaging Het
Pcgf2 A G 11: 97,691,850 probably benign Het
Pde3a T C 6: 141,459,316 probably benign Het
Pibf1 C T 14: 99,112,973 R186C probably damaging Het
Pitrm1 A G 13: 6,558,244 D335G probably benign Het
Pkp4 T C 2: 59,338,765 L752P probably damaging Het
Plcb3 C A 19: 6,961,913 E566* probably null Het
Prune2 T C 19: 17,125,222 S2582P probably benign Het
Reln A T 5: 22,034,775 D831E probably benign Het
Samd9l T A 6: 3,374,267 D998V probably benign Het
Sardh G A 2: 27,191,919 T865I possibly damaging Het
Setbp1 G A 18: 78,857,860 T864I probably damaging Het
Slc9a1 T A 4: 133,370,548 M2K probably benign Het
Sorbs2 A G 8: 45,795,730 T593A probably benign Het
Svs5 A T 2: 164,333,587 I120L probably benign Het
Tcl1b1 G T 12: 105,159,815 V19F probably damaging Het
Ttc30a1 A T 2: 75,979,976 C588S probably damaging Het
Urgcp T C 11: 5,716,004 N778S probably benign Het
Vnn1 A T 10: 23,899,601 I250F possibly damaging Het
Xntrpc A G 7: 102,082,974 R365G possibly damaging Het
Zfp84 T A 7: 29,771,372 M1K probably null Het
Zfyve26 G A 12: 79,280,067 R761C probably damaging Het
Zp3r A G 1: 130,577,884 probably null Het
Other mutations in Acp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Acp2 APN 2 91203683 missense probably damaging 1.00
IGL02251:Acp2 APN 2 91208333 unclassified probably null
IGL02445:Acp2 APN 2 91206261 missense possibly damaging 0.63
IGL02952:Acp2 APN 2 91208443 unclassified probably benign
IGL03272:Acp2 APN 2 91204233 splice site probably benign
R0781:Acp2 UTSW 2 91208422 unclassified probably null
R2107:Acp2 UTSW 2 91203595 splice site probably benign
R4382:Acp2 UTSW 2 91208109 missense possibly damaging 0.80
R4726:Acp2 UTSW 2 91204277 missense probably damaging 1.00
R4737:Acp2 UTSW 2 91210723 missense probably benign 0.26
R4793:Acp2 UTSW 2 91206789 missense probably benign 0.13
R4817:Acp2 UTSW 2 91203618 missense probably damaging 1.00
R5089:Acp2 UTSW 2 91211922 unclassified probably benign
R5092:Acp2 UTSW 2 91208046 missense probably benign 0.19
R5468:Acp2 UTSW 2 91206098 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCATGGTGAGCATCCCTATCTTG -3'
(R):5'- AGTGGAGAGGCTGCACCTGAATAC -3'

Sequencing Primer
(F):5'- GAGCATCCCTATCTTGCTTCCTG -3'
(R):5'- gatagatggggtgggagaatg -3'
Posted On2014-01-05