Incidental Mutation 'R1019:Slc6a18'
ID96789
Institutional Source Beutler Lab
Gene Symbol Slc6a18
Ensembl Gene ENSMUSG00000021612
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 18
SynonymsXtrp2, D630001K16Rik, XT2
MMRRC Submission 039123-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1019 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location73661752-73678023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73677879 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 17 (R17S)
Ref Sequence ENSEMBL: ENSMUSP00000152146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022048] [ENSMUST00000022105] [ENSMUST00000109679] [ENSMUST00000109680] [ENSMUST00000220650] [ENSMUST00000221026] [ENSMUST00000221987] [ENSMUST00000222029] [ENSMUST00000223026] [ENSMUST00000223074]
Predicted Effect probably benign
Transcript: ENSMUST00000022048
SMART Domains Protein: ENSMUSP00000022048
Gene: ENSMUSG00000021565

DomainStartEndE-ValueType
Pfam:SNF 32 608 2.3e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000022105
AA Change: R17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612
AA Change: R17S

DomainStartEndE-ValueType
Pfam:SNF 17 593 2.1e-182 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109679
AA Change: R17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105301
Gene: ENSMUSG00000021612
AA Change: R17S

DomainStartEndE-ValueType
Pfam:SNF 17 511 6.8e-164 PFAM
low complexity region 513 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109680
AA Change: R17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105302
Gene: ENSMUSG00000021612
AA Change: R17S

DomainStartEndE-ValueType
Pfam:SNF 17 325 2.1e-126 PFAM
Pfam:SNF 392 555 9.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132085
Predicted Effect probably damaging
Transcript: ENSMUST00000220650
AA Change: R17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221026
AA Change: R17S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000221987
AA Change: R17S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000222029
AA Change: R17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223026
AA Change: R17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223074
AA Change: R17S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC6 family of proteins, which includes SLC6A18, act as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Homozygous null mice are overtly normal but have increased blood pressure associated with impaired renal accumulation of glycine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G C 8: 120,145,470 E46Q probably damaging Het
9130401M01Rik A G 15: 58,022,427 I353T possibly damaging Het
A830031A19Rik G A 11: 24,049,438 R53C unknown Het
Abcc6 T C 7: 46,014,107 R378G possibly damaging Het
Adam10 A G 9: 70,761,640 N413D probably benign Het
Csmd2 T C 4: 128,522,014 V2712A probably benign Het
Dnhd1 T C 7: 105,709,171 F3289S probably damaging Het
Hectd1 A G 12: 51,748,657 S2330P probably damaging Het
Ift74 C T 4: 94,635,835 A196V probably benign Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lipo2 A T 19: 33,730,857 C252* probably null Het
Mrgpra1 C G 7: 47,335,085 C282S probably benign Het
Nfatc2 A T 2: 168,504,879 L765Q probably damaging Het
Olfr355 A G 2: 36,927,752 F121L probably benign Het
Olfr541 C T 7: 140,704,494 P81L probably damaging Het
Otof C A 5: 30,370,743 V1924L probably damaging Het
Pdhb T C 14: 8,171,442 Q62R probably benign Het
Plbd1 A G 6: 136,651,905 V55A probably benign Het
Poteg T A 8: 27,447,824 F3I possibly damaging Het
Rptor A G 11: 119,843,743 D46G probably damaging Het
Slc18a1 C T 8: 69,075,033 probably null Het
Slc37a1 A G 17: 31,315,594 N80S probably benign Het
Spata31d1a A G 13: 59,702,368 S649P probably benign Het
Syngr3 G T 17: 24,687,560 Q94K possibly damaging Het
Tgm2 C A 2: 158,124,154 E527* probably null Het
Tnc T A 4: 63,962,082 T1952S probably damaging Het
Ubqln3 C T 7: 104,141,386 R499Q probably benign Het
Uck1 A G 2: 32,256,193 V230A possibly damaging Het
Unc13d G A 11: 116,068,074 R754C probably benign Het
Zfp708 C T 13: 67,074,098 A73T probably benign Het
Other mutations in Slc6a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Slc6a18 APN 13 73671719 missense possibly damaging 0.82
IGL01370:Slc6a18 APN 13 73667031 missense probably damaging 1.00
IGL01959:Slc6a18 APN 13 73677865 missense probably damaging 1.00
IGL02096:Slc6a18 APN 13 73672751 missense probably benign 0.05
IGL02147:Slc6a18 APN 13 73668162 missense probably damaging 0.97
IGL02167:Slc6a18 APN 13 73666472 critical splice acceptor site probably null
IGL02465:Slc6a18 APN 13 73677785 missense probably benign 0.11
IGL02548:Slc6a18 APN 13 73669995 missense probably damaging 1.00
IGL02720:Slc6a18 APN 13 73669968 missense probably benign 0.16
IGL03341:Slc6a18 APN 13 73677923 missense probably benign 0.07
R0011:Slc6a18 UTSW 13 73665619 missense possibly damaging 0.59
R0219:Slc6a18 UTSW 13 73674632 splice site probably null
R0884:Slc6a18 UTSW 13 73667037 missense probably damaging 1.00
R1610:Slc6a18 UTSW 13 73668225 missense probably benign 0.10
R1901:Slc6a18 UTSW 13 73670043 missense probably benign 0.39
R1969:Slc6a18 UTSW 13 73664189 missense possibly damaging 0.66
R2014:Slc6a18 UTSW 13 73675725 missense probably benign 0.02
R2445:Slc6a18 UTSW 13 73666752 nonsense probably null
R2504:Slc6a18 UTSW 13 73675806 missense probably benign 0.01
R3125:Slc6a18 UTSW 13 73677802 missense probably damaging 1.00
R4084:Slc6a18 UTSW 13 73667029 missense probably benign 0.39
R4571:Slc6a18 UTSW 13 73666370 missense possibly damaging 0.59
R4735:Slc6a18 UTSW 13 73666435 missense probably benign 0.42
R5032:Slc6a18 UTSW 13 73666323 missense probably damaging 1.00
R5859:Slc6a18 UTSW 13 73668159 missense probably benign 0.01
R6258:Slc6a18 UTSW 13 73670045 nonsense probably null
R6350:Slc6a18 UTSW 13 73677925 missense possibly damaging 0.80
R6370:Slc6a18 UTSW 13 73668159 missense probably benign 0.21
R6640:Slc6a18 UTSW 13 73664282 missense possibly damaging 0.95
R6747:Slc6a18 UTSW 13 73677991 start gained probably benign
R7267:Slc6a18 UTSW 13 73671636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGATGGGACTCAAAGACACTG -3'
(R):5'- TAAATGCCTCAAGGAGGGCCTGAC -3'

Sequencing Primer
(F):5'- AGACACTGAGCTATTCTTGGGAC -3'
(R):5'- GACTGCTTCAGCTTCCTCAGAG -3'
Posted On2014-01-05