Phenotypic Mutation 'costello'

• Allele: costello
• Mutation Type: missense
• Chromosome: 2
• Coordinate: 167,293,216 bp (GRCm39)
• Base Change: T ⇒ A (forward strand)
• Gene: Slc9a8
• Gene Name: solute carrier family 9 (sodium/hydrogen exchanger), member 8
• Synonym(s): 1200006P13Rik, 6430709P13Rik, NHE8
• Chromosomal Location: 167,263,632-167,318,920 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015] ; PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Methionine changed to Lysine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000044185] [ENSMUSP00000073536] [ENSMUSP00000104841]
• AlphaFold: Q8R4D1
• SMART Domains: Protein: ENSMUSP00000044185; Gene: ENSMUSG00000039463; AA Change: M215K

Domain	Start	End	E-Value	Type
low complexity region	44	51	N/A	INTRINSIC
Pfam:Na_H_Exchanger	57	468	3.3e-69	PFAM
low complexity region	497	513	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000047815)
• SMART Domains: Protein: ENSMUSP00000073536; Gene: ENSMUSG00000039463; AA Change: M188K

Domain	Start	End	E-Value	Type
low complexity region	44	51	N/A	INTRINSIC
Pfam:Na_H_Exchanger	54	441	3.5e-62	PFAM
low complexity region	470	486	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000073873)
• SMART Domains: Protein: ENSMUSP00000104841; Gene: ENSMUSG00000039463; AA Change: M188K

Domain	Start	End	E-Value	Type
low complexity region	44	51	N/A	INTRINSIC
Pfam:Na_H_Exchanger	54	437	3.7e-61	PFAM
low complexity region	466	482	N/A	INTRINSIC

• Predicted Effect: probably damaging ; PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
  (Using ENSMUST00000109218)
• Meta Mutation Damage Score: 0.9531
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, gDNA
• Last Updated: 2022-04-12 3:40 PM by External Program
• Record Created: 2013-10-08 1:18 PM by Emre Turer
• Record Posted: 2018-09-18
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine, Katherine Timer
• Authors: Emre Turer and Bruce Beutler

Accession Number

NCBI RefSeq: NM_148929 (variant 1), NM_001304540 (variant 3), NM_001304542 (variant 4); MGI:1924281

Alleles Listed at MGI

All Mutations and Alleles(156) : Chemically induced (ENU)(1) Gene trapped(151) Targeted(4)

Phenotypic Description

Figure 1. Costello mice exhibited a DSS-induced colitis phenotype at day 7. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The costello phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0270, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days after DSS exposure (Figure 1); weight loss is used to measure DSS susceptibility.

Nature of Mutation

Figure 2. Linkage mapping of the DSS-induced colitis phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 110 mutations (X-axis) identified in the G1 male of pedigree R0270. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Figure 3. Mice expressing a CRISPR-mediated knockout of Slc9a8 recapitulated the costello phenotype . Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 110 mutations. The DSS sensitivity phenotype was linked by continuous variable mapping to a mutation in Slc9a8:  a T to A transversion at base pair 167,451,296 (v38) on chromosome 2, or base pair 29,620 in the GenBank genomic region NC_000068 encoding Slc9a8. Linkage was found with a recessive model of inheritance, wherein one variant homozygote departed phenotypically from 10 homozygous reference mice and 23 heterozygous mice with a P value of 1.18 x 10^-4 (Figure 2).  

The mutation corresponds to residue 686 in the mRNA sequence NM_148929 within exon 8 of 17 total exons.

670 GACCCTGTGCTCAACATGCTGGTGTTTGGAGAA 210 -D--P--V--L--N--M--L--V--F--G--E-

The mutated nucleotide is indicated in red.  The mutation results in a methionine (M) to lysine (K) substitution at position 215 (M215K) in the SLC9A8 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

The causative mutation in Slc9a8 for the DSS sensitivity phenotype was confirmed by CRISPR-mediated knockout of Slc9a8 (Figure 3; P = 3.42 x 10^-13).

Protein Prediction

Figure 4. Domain organization of SLC9A8. SLC9A8 has 12 putative transmembrane domains. Other motifs and domains have not been reported. The location of the costello mutation is indicated. Domain information is from SMART and UniProt.

SLC9A8 (alternatively, NHE8) is a member of solute carrier (SLC) family 9. The SLC superfamily encodes intrinsic membrane transporters comprising 55 gene families and 362 putatively functional protein-coding genes. The gene products include passive transporters, symporters, and antiporters that transport a wide variety of substrates, including amino acids, oligopeptides, glucose, inorganic cations and anions, bile salts, carboxylate, acetyl coenzyme A, essential metals, neurotransmitters, vitamins, fatty acids, lipids, nucleosides, ammonium, choline, thyroid hormone, and urea.

SLC family members have a variable number of transmembrane domains; mouse SLC9A8 is predicted to have 12 transmembrane domains (Figure 4; UniProt). The loop between transmembrane domains 7 and 8 resembles a pore (P)-loop structure seen in ion channels and pumps. The N- and C-termini are cytoplasmic. The C-terminal tail has three putative phosphorylation sites (Thr505, Ser566, and Ser568) and mediates binding to ancillary factors. Other motifs and domains in SLC9A8 have not been reported.

The costello mutation results in a methionine (M) to lysine (K) substitution at position 215 (M215K) in the SLC9A8 protein; amino acid 215 is within transmembrane domain 6.

Expression/Localization

SLC9A8 is expressed at low levels in most adult tissues (1). SLC9A8 is expressed at higher levels in the gastrointestinal tract, brain, retina, and testis (2). SLC9A8 is expressed at the apical membrane of the epithelial cells in the intestine and the kidney as well as in retinal pigment epithelial cells and photoreceptor cells (3).

SLC9A8 expression in goblet cells is downregulated by TNF-α (4;5) and epidermal growth factor (EGF; see the record Velvet for information about the EGF receptor) (6). The metabolite butyrate (7) and the peptide hormone somatostatin induced SLC9A8 expression (8).

Background

Figure 5. NHE8/SLC9A8 function within intestinal cells. SLC9A8 is expressed on the apical surface of intestinal epithelial cells and functions in both sodium absorption and bicarbonate secretion in the intestine. It also aids in nutrient absorption, protection of intestinal epithelia, and mucin production by goblet cells.

SLC9A8 is a sodium-hydrogen exchanger. Sodium-hydrogen exchangers have multiple functions, including maintaining intracellular pH homeostasis, cell volume regulation, electroneutral NaCl absorption in epithelia, cell proliferation, organelle biogenesis, and protein trafficking [(2); reviewed in (9)].

SLC9A8 has a putative function in the maintenance of endosome morphology (10). Loss of SLC9A8 expression resulted in aberrant multivesicular body protein sorting, and SLC9A8-deficient cells showed perinuclear clustering of endosomes and lysosomes.

SLC9A8 functions in both retinal pigment epithelium (RPE) and photoreceptor cells. SLC9A8 is required to maintain RPE cell polarity and photoreceptor survival (11). SLC9A8 putatively functions in regulating pH and sodium homeostasis during protein trafficking in the trans-Golgi network (3;11;12). Slc9a8-deficient (Slc9a8^-/-) mice exhibited separation of photoreceptors from the RPE, reduction in photoreceptor length, photoreceptor cell loss, and mislocalization of visual pigments (12). Subretinal injection of AAV-packaged nuclease null NmCas9 and Slc9a8-specific single guide RNAs into mouse eyes resulted in photoreceptor cells and RPE cell degeneration (3). The Slc9a8^-/- mice also showed reduced tear production and increased corneal staining (13)

SLC9A8 functions in acrosome formation and Leydig cell function in the testes (14;15). Acrosomes are a secretory organelle on the anterior part of the sperm nucleus formed by fusion of Golgi-derived vesicles. SLC9A8 localizes to the developing acrosome of spermatids (15). Slc9a8^-/- male mice are infertile due to disrupted acrosome formation, reduced sperm motility, and abnormal mitochondrial distribution in the sperm (15). The level of serum testosterone and the expression of luteinizing hormone receptor were reduced in the Slc9a8^-/- male mice (14).

SLC9A8 functions in sodium absorption and bicarbonate secretion in the intestine as well as nutrient absorption by enterocytes, protection of intestinal epithelia from infectious bacterial adherence, and mucin production by goblet cells (Figure 5) (16-18). Slc9a8^-/- mice exhibited decreased mucosal surface pH in the colon, reduced goblet cell numbers in the colon, increased cecum length, increased small intestine length, elongated crypts in the ileum, abnormal blood coagulation, increased bacterial adhesion and inflammation mainly in the distal colon, and disrupted mucin production after DSS challenge (16-19). SLC9A8 expression is inhibited/reduced during colitis (20). Somatostatin-induced increased SLC9A8 intestinal expression improved the symptoms of mice with infectious colitis (21).

Putative Mechanism

The DSS susceptibility phenotype observed in the costello mice indicates loss of SLC9A8-associated function in the intestine. The colon and intestine of the costello mice have not been examined, but the DSS susceptibility phenotype indicates that the mice exhibit similar phenotypes to that of Slc9a8^-/- mice, including reduced goblet cell numbers in the colon and disrupted mucin production after DSS challenge (16-19).

Primers

PCR Primer
costello_pcr_F: TGCTAGAACAGAGTGTGGTGCAGC
costello_pcr_R: CTGTCAGAGTGGCAAGATGCAGTC

Sequencing Primer
costello_seq_F: AACCAGGCTCAGCACTGTG
costello_seq_R: CAGTCGTGAGTTGACCACATAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 439 nucleotides is amplified (chromosome 2, + strand):

1   tgctagaaca gagtgtggtg cagctgggaa accaggctca gcactgtgtc ctggcctcct
61  gctcctgtgc taggtgagtg tgggcgtgag ccggtaagca cagcctctcg ccatctcagc
121 accacatccc aagcacagct gtgtgcaccc agctccacgc tttacacagt ctgccctcgc
181 ttctctcctt gcagtttcgc atttggctcc ctgatatctg cagtcgaccc agtcgccact
241 attgcgattt tcaacgcact gcatgtggac cctgtgctca acatgctggt gtttggagaa
301 agcattctca acgatgcagt ctccatcgtc ctcaccaagt aagtaggaag gactggaagg
361 tccctacagc acactgacgc cagcacacag gctggtccct atgtggtcaa ctcacgactg
421 catcttgcca ctctgacag

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Nagase, T., Ishikawa, K., Suyama, M., Kikuno, R., Hirosawa, M., Miyajima, N., Tanaka, A., Kotani, H., Nomura, N., and Ohara, O. (1999) Prediction of the Coding Sequences of Unidentified Human Genes. XIII. the Complete Sequences of 100 New cDNA Clones from Brain which Code for Large Proteins in Vitro. DNA Res. 6, 63-70.

  2. Xu, H., Chen, H., Dong, J., Lynch, R., and Ghishan, F. K. (2008) Gastrointestinal Distribution and Kinetic Characterization of the Sodium-Hydrogen Exchanger Isoform 8 (NHE8). Cell Physiol Biochem. 21, 109-116.

  3. Xia, C. H., Ferguson, I., Li, M., Kim, A., Onishi, A., Li, L., Su, B., and Gong, X. (2018) Essential Function of NHE8 in Mouse Retina Demonstrated by AAV-Mediated CRISPR/Cas9 Knockdown. Exp Eye Res. 176, 29-39.

  4. Xu, H., Chen, H., Dong, J., Li, J., Chen, R., Uno, J. K., and Ghishan, F. K. (2009) Tumor Necrosis Factor-{Alpha} Downregulates Intestinal NHE8 Expression by Reducing Basal Promoter Activity. Am J Physiol Cell Physiol. 296, C489-97.

  5. Xu, H., Li, Q., Zhao, Y., Li, J., and Ghishan, F. K. (2016) Intestinal NHE8 is Highly Expressed in Goblet Cells and its Expression is Subject to TNF-Alpha Regulation. Am J Physiol Gastrointest Liver Physiol. 310, G64-9.

  6. Xu, H., Zhang, B., Li, J., Chen, H., Tooley, J., and Ghishan, F. K. (2010) Epidermal Growth Factor Inhibits Intestinal NHE8 Expression Via Reducing its Basal Transcription. Am J Physiol Cell Physiol. 299, C51-7.

  7. Xu, H., McCoy, A., Li, J., Zhao, Y., and Ghishan, F. K. (2015) Sodium Butyrate Stimulates NHE8 Expression Via its Role on Activating NHE8 Basal Promoter Activity. Am J Physiol Gastrointest Liver Physiol. 309, G500-5.

  8. Wang, C., Xu, H., Chen, H., Li, J., Zhang, B., Tang, C., and Ghishan, F. K. (2011) Somatostatin Stimulates Intestinal NHE8 Expression Via p38 MAPK Pathway. Am J Physiol Cell Physiol. 300, C375-82.

  9. Orlowski, J., and Grinstein, S. (2004) Diversity of the Mammalian sodium/proton Exchanger SLC9 Gene Family. Pflugers Arch. 447, 549-565.

  10. Lawrence, S. P., Bright, N. A., Luzio, J. P., and Bowers, K. (2010) The sodium/proton Exchanger NHE8 Regulates Late Endosomal Morphology and Function. Mol Biol Cell. 21, 3540-3551.

  11. Xia, C. H., Liu, H., Cheung, D., Tang, F., Chang, B., Li, M., and Gong, X. (2015) NHE8 is Essential for RPE Cell Polarity and Photoreceptor Survival. Sci Rep. 5, 9358.

  12. Jadeja, S., Barnard, A. R., McKie, L., Cross, S. H., White, J. K., Sanger Mouse Genetics Project, Robertson, M., Budd, P. S., MacLaren, R. E., and Jackson, I. J. (2015) Mouse slc9a8 Mutants Exhibit Retinal Defects due to Retinal Pigmented Epithelium Dysfunction. Invest Ophthalmol Vis Sci. 56, 3015-3026.

  13. Xu, H., Zhao, Y., Li, J., Wang, M., Lian, F., Gao, M., and Ghishan, F. K. (2015) Loss of NHE8 Expression Impairs Ocular Surface Function in Mice. Am J Physiol Cell Physiol. 308, C79-87.

  14. Xu, H., Chen, H., Li, J., Zhao, Y., and Ghishan, F. K. (2015) Disruption of NHE8 Expression Impairs Leydig Cell Function in the Testes. Am J Physiol Cell Physiol. 308, C330-8.

  15. Oberheide, K., Puchkov, D., and Jentsch, T. J. (2017) Loss of the Na(+)/H(+) Exchanger NHE8 Causes Male Infertility in Mice by Disrupting Acrosome Formation. J Biol Chem. 292, 10845-10854.

  16. Xu, H., Zhang, B., Li, J., Wang, C., Chen, H., and Ghishan, F. K. (2012) Impaired Mucin Synthesis and Bicarbonate Secretion in the Colon of NHE8 Knockout Mice. Am J Physiol Gastrointest Liver Physiol. 303, G335-43.

  17. Xu, H., Li, J., Chen, H., Wang, C., and Ghishan, F. K. (2013) NHE8 Plays Important Roles in Gastric Mucosal Protection. Am J Physiol Gastrointest Liver Physiol. 304, G257-61.

  18. Liu, C., Xu, H., Zhang, B., Johansson, M. E., Li, J., Hansson, G. C., and Ghishan, F. K. (2013) NHE8 Plays an Important Role in Mucosal Protection Via its Effect on Bacterial Adhesion. Am J Physiol Cell Physiol. 305, C121-8.

  19. Wang, A., Li, J., Zhao, Y., Johansson, M. E., Xu, H., and Ghishan, F. K. (2015) Loss of NHE8 Expression Impairs Intestinal Mucosal Integrity. Am J Physiol Gastrointest Liver Physiol. 309, G855-64.

  20. Li, X., Cai, L., Xu, H., Geng, C., Lu, J., Tao, L., Sun, D., Ghishan, F. K., and Wang, C. (2016) Somatostatin Regulates NHE8 Protein Expression Via the ERK1/2 MAPK Pathway in DSS-Induced Colitis Mice. Am J Physiol Gastrointest Liver Physiol. 311, G954-G963.

  21. Lei, X., Cai, L., Li, X., Xu, H., Geng, C., and Wang, C. (2018) Up-Regulation of NHE8 by Somatostatin Ameliorates the Diarrhea Symptom in Infectious Colitis Mice Model. Korean J Physiol Pharmacol. 22, 269-275.