Incidental Mutation 'R4499:Slc9a8'
ID331737
Institutional Source Beutler Lab
Gene Symbol Slc9a8
Ensembl Gene ENSMUSG00000039463
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 8
Synonyms1200006P13Rik, 6430709P13Rik, NHE8
MMRRC Submission 041752-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4499 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167421712-167477000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167424193 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 30 (L30Q)
Ref Sequence ENSEMBL: ENSMUSP00000073536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047815] [ENSMUST00000073873] [ENSMUST00000109218]
Predicted Effect probably benign
Transcript: ENSMUST00000047815
AA Change: L30Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000044185
Gene: ENSMUSG00000039463
AA Change: L30Q

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 57 468 3.3e-69 PFAM
low complexity region 497 513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073873
AA Change: L30Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000073536
Gene: ENSMUSG00000039463
AA Change: L30Q

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 441 3.5e-62 PFAM
low complexity region 470 486 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109218
AA Change: L30Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104841
Gene: ENSMUSG00000039463
AA Change: L30Q

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
Pfam:Na_H_Exchanger 54 437 3.7e-61 PFAM
low complexity region 466 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150326
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 92% (47/51)
MGI Phenotype FUNCTION: This gene encodes a member of the Na+/H+ exchanger (NHE) family of integral membrane transporter proteins. The encoded protein is expressed on the apical membrane of the intestinal epithelial cells and plays an important role in mucosal protection. Loss of the encoded protein in mice results in a decrease in the number of goblet and mucin-positive cells, disorganization of the mucin layer, and a decrease in mucosal pH in the colon. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male infertility, impaired mucin synthesis and bicarbonate secretion in the colon, abnormal blood coagulation and increased length of the small intestine, cecum and ileum crypts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,527 W948R possibly damaging Het
Ache A C 5: 137,291,932 M508L probably damaging Het
Adgrb2 A T 4: 129,992,661 E198V probably damaging Het
Adgrl4 A G 3: 151,510,785 N535S possibly damaging Het
Agbl3 T C 6: 34,857,598 S906P probably benign Het
Akna T C 4: 63,395,041 T282A probably benign Het
Arfgef2 G A 2: 166,885,814 V1561M probably damaging Het
Arfgef3 T C 10: 18,608,343 D1388G possibly damaging Het
Asnsd1 A G 1: 53,347,970 V166A probably benign Het
Bank1 T C 3: 136,284,243 I29V probably benign Het
Bpifb5 A T 2: 154,240,758 I484F possibly damaging Het
Camta2 T C 11: 70,674,686 E788G probably damaging Het
Ccdc18 T G 5: 108,228,960 S1422R possibly damaging Het
Cdc42bpg C T 19: 6,320,555 P1226L possibly damaging Het
Cep126 T C 9: 8,101,588 N315S possibly damaging Het
Dcaf4 T A 12: 83,539,360 L367Q probably damaging Het
Dcc A T 18: 71,547,317 V616D probably benign Het
Dennd4a G A 9: 64,910,123 D1680N possibly damaging Het
Dgkq C G 5: 108,649,661 E788D possibly damaging Het
Dpep2 T C 8: 105,985,482 E282G probably benign Het
Gm14124 T G 2: 150,269,442 V684G possibly damaging Het
Gm8221 T A 15: 77,626,045 noncoding transcript Het
Ice1 T C 13: 70,609,027 S280G possibly damaging Het
Lrrc2 A T 9: 110,962,645 Q155L probably benign Het
Mesd G A 7: 83,897,977 R216Q probably benign Het
Msh6 T A 17: 87,980,269 N112K probably damaging Het
Myo15b A G 11: 115,890,952 E307G probably benign Het
Nod1 T A 6: 54,943,996 N446Y probably damaging Het
Nrap G A 19: 56,351,481 T787I probably damaging Het
P2ry12 A G 3: 59,217,657 I199T probably damaging Het
Prr11 T G 11: 87,098,707 K279N possibly damaging Het
Psg25 C T 7: 18,524,891 E287K possibly damaging Het
Rusc1 T C 3: 89,092,308 S56G probably benign Het
Slc16a7 T C 10: 125,228,187 N427S probably damaging Het
Slc47a1 T A 11: 61,359,529 I341L probably benign Het
Ssh2 T A 11: 77,393,067 L49* probably null Het
Stard9 T A 2: 120,700,241 D2326E probably benign Het
Thbs1 T C 2: 118,119,950 I688T possibly damaging Het
Ttn T A 2: 76,916,478 E4742D probably benign Het
Vps37b T C 5: 124,007,626 I117V probably damaging Het
Xirp2 A T 2: 67,513,438 M2008L probably benign Het
Zfp53 A G 17: 21,509,235 E510G probably damaging Het
Zswim8 T A 14: 20,714,297 S578R probably benign Het
Other mutations in Slc9a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Slc9a8 APN 2 167424166 missense possibly damaging 0.46
IGL02626:Slc9a8 APN 2 167467677 splice site probably benign
costello UTSW 2 167451296 missense probably damaging 1.00
R0270:Slc9a8 UTSW 2 167451296 missense probably damaging 1.00
R0417:Slc9a8 UTSW 2 167457344 missense probably benign 0.00
R0504:Slc9a8 UTSW 2 167424205 missense probably benign
R0906:Slc9a8 UTSW 2 167434867 intron probably benign
R1216:Slc9a8 UTSW 2 167424121 missense probably benign 0.00
R1225:Slc9a8 UTSW 2 167471523 missense probably benign 0.20
R1604:Slc9a8 UTSW 2 167471432 missense probably benign 0.09
R1728:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1729:Slc9a8 UTSW 2 167424145 missense probably benign 0.00
R1773:Slc9a8 UTSW 2 167471465 missense possibly damaging 0.57
R1775:Slc9a8 UTSW 2 167457358 missense probably benign 0.12
R1918:Slc9a8 UTSW 2 167424214 missense possibly damaging 0.95
R2312:Slc9a8 UTSW 2 167451276 missense probably benign 0.01
R3031:Slc9a8 UTSW 2 167451281 missense probably damaging 1.00
R3752:Slc9a8 UTSW 2 167457352 missense probably benign
R3757:Slc9a8 UTSW 2 167424130 missense probably benign 0.01
R4746:Slc9a8 UTSW 2 167441170 nonsense probably null
R4904:Slc9a8 UTSW 2 167471396 missense possibly damaging 0.51
R4969:Slc9a8 UTSW 2 167446529 missense probably benign 0.06
R5395:Slc9a8 UTSW 2 167467722 missense probably damaging 0.99
R5811:Slc9a8 UTSW 2 167471387 nonsense probably null
R5908:Slc9a8 UTSW 2 167451170 intron probably benign
R6311:Slc9a8 UTSW 2 167451220 missense probably damaging 1.00
R6443:Slc9a8 UTSW 2 167434821 missense probably benign 0.00
R6494:Slc9a8 UTSW 2 167424291 missense probably damaging 1.00
R7161:Slc9a8 UTSW 2 167465383 missense possibly damaging 0.90
R7322:Slc9a8 UTSW 2 167451302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATAATAGAAGTCTCTGGTGTGC -3'
(R):5'- TCAAAAGCTAAGACATTGCTCTCTG -3'

Sequencing Primer
(F):5'- TTCAAGGCCTGTCTGCTG -3'
(R):5'- GCTAAGACATTGCTCTCTGGAACTG -3'
Posted On2015-07-21