Phenotypic Mutation 'nymph' (pdf version)
Allelenymph
Mutation Type missense
Chromosome15
Coordinate101,035,646 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Scn8a
Gene Name sodium channel, voltage-gated, type VIII, alpha
Synonym(s) mnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6
Chromosomal Location 100,869,858-101,045,938 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001077499, NM_011323; MGI:103169

Mapped Yes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000080842] [ENSMUSP00000104536] [ENSMUSP00000104537] [ENSMUSP00000104538] [ENSMUSP00000144371] [ENSMUSP00000144013]
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: Y1577C

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000082209)
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: Y1577C

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000108908)
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: Y1587C

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000108909)
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: Y1577C

DomainStartEndE-ValueType
Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000108910)
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: Y1536C

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000200963)
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: Y1577C

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000201549)
Meta Mutation Damage Score 0.858 question?
Is this an essential gene? Probably essential (E-score: 0.867) question?
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological 19737145
Body Weight - decreased 11532991
growth/size 19737145
Candidate Explorer Status CE: potential candidate; human score: -0.5; ML prob: 0.312
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(25) : Chemically induced (ENU)(9) Endonuclease-mediated(1) Gene trapped(3) Radiation induced(1) Spontaneous(6) Targeted(4) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100955532 unclassified probably benign
IGL00979:Scn8a APN 15 100955406 unclassified probably benign
IGL01339:Scn8a APN 15 101032201 missense probably benign
IGL01992:Scn8a APN 15 100969057 missense probably damaging 1.00
IGL02215:Scn8a APN 15 101029572 splice site probably null
IGL02311:Scn8a APN 15 101013283 missense probably damaging 0.97
IGL02404:Scn8a APN 15 101039730 missense probably damaging 1.00
IGL02652:Scn8a APN 15 101013476 missense probably damaging 0.98
IGL02690:Scn8a APN 15 100970254 missense probably damaging 1.00
IGL02704:Scn8a APN 15 101008062 missense possibly damaging 0.94
IGL03084:Scn8a APN 15 101017172 missense probably damaging 1.00
IGL03108:Scn8a APN 15 100974615 missense probably benign
IGL03224:Scn8a APN 15 101035639 missense probably damaging 1.00
dan UTSW 15 101035624 nonsense probably null
Tremord UTSW 15 101013504 missense probably damaging 1.00
3-1:Scn8a UTSW 15 101039939 missense probably benign 0.04
PIT4280001:Scn8a UTSW 15 100957489 missense probably damaging 1.00
PIT4508001:Scn8a UTSW 15 101029692 missense probably damaging 0.98
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0254:Scn8a UTSW 15 101018364 missense probably damaging 1.00
R0412:Scn8a UTSW 15 101008306 splice site probably benign
R0538:Scn8a UTSW 15 101035624 nonsense probably null
R0539:Scn8a UTSW 15 101016568 missense probably damaging 1.00
R0631:Scn8a UTSW 15 101035537 missense probably damaging 1.00
R0726:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R0945:Scn8a UTSW 15 101015787 missense possibly damaging 0.54
R0967:Scn8a UTSW 15 101035646 missense probably damaging 1.00
R1164:Scn8a UTSW 15 101040162 missense probably benign 0.06
R1283:Scn8a UTSW 15 100969171 missense possibly damaging 0.82
R1368:Scn8a UTSW 15 101035541 missense probably damaging 1.00
R1633:Scn8a UTSW 15 101029815 missense probably benign 0.01
R1669:Scn8a UTSW 15 101011120 missense probably damaging 1.00
R1694:Scn8a UTSW 15 100955528 nonsense probably null
R1735:Scn8a UTSW 15 101015861 missense possibly damaging 0.94
R1773:Scn8a UTSW 15 101039615 missense probably damaging 0.97
R1940:Scn8a UTSW 15 100970204 missense probably benign 0.22
R1996:Scn8a UTSW 15 101024379 missense probably damaging 1.00
R2107:Scn8a UTSW 15 101018363 missense probably damaging 0.99
R2251:Scn8a UTSW 15 101017106 missense probably benign 0.02
R2516:Scn8a UTSW 15 100969162 missense probably benign 0.05
R2917:Scn8a UTSW 15 101039732 missense probably damaging 1.00
R3417:Scn8a UTSW 15 100971668 splice site probably benign
R3896:Scn8a UTSW 15 101035498 missense probably benign
R4024:Scn8a UTSW 15 101039793 missense probably damaging 1.00
R4050:Scn8a UTSW 15 101013413 nonsense probably null
R4193:Scn8a UTSW 15 100971603 missense probably damaging 1.00
R4212:Scn8a UTSW 15 100957073 missense possibly damaging 0.88
R4358:Scn8a UTSW 15 100940133 missense probably benign 0.00
R4396:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R4428:Scn8a UTSW 15 100983903 missense probably damaging 1.00
R4452:Scn8a UTSW 15 100957091 missense possibly damaging 0.95
R4631:Scn8a UTSW 15 101016503 nonsense probably null
R4693:Scn8a UTSW 15 101015691 missense probably damaging 1.00
R4765:Scn8a UTSW 15 101040471 missense probably benign 0.07
R4777:Scn8a UTSW 15 101015951 missense probably damaging 1.00
R4949:Scn8a UTSW 15 101029782 missense probably damaging 1.00
R4997:Scn8a UTSW 15 100957054 missense probably damaging 1.00
R5246:Scn8a UTSW 15 101011057 missense probably damaging 1.00
R5566:Scn8a UTSW 15 100974534 missense probably damaging 1.00
R5875:Scn8a UTSW 15 100972822 nonsense probably null
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6057:Scn8a UTSW 15 100974667 missense possibly damaging 0.94
R6114:Scn8a UTSW 15 101040596 missense probably damaging 0.99
R6362:Scn8a UTSW 15 100940115 unclassified probably null
R6535:Scn8a UTSW 15 100959707 intron probably benign
R6677:Scn8a UTSW 15 100969072 missense probably damaging 1.00
R6687:Scn8a UTSW 15 100974627 missense probably benign 0.12
R6701:Scn8a UTSW 15 101040096 missense probably damaging 1.00
R6719:Scn8a UTSW 15 101011015 critical splice acceptor site probably null
R6739:Scn8a UTSW 15 101015955 missense possibly damaging 0.82
R6769:Scn8a UTSW 15 101035564 missense probably benign
R6786:Scn8a UTSW 15 101032215 missense probably benign 0.00
R6849:Scn8a UTSW 15 100955587 intron probably null
R7108:Scn8a UTSW 15 101039778 missense probably benign 0.01
R7215:Scn8a UTSW 15 101029830 missense possibly damaging 0.80
R7217:Scn8a UTSW 15 100970227 missense probably benign 0.00
R7219:Scn8a UTSW 15 100969103 missense probably damaging 1.00
R7356:Scn8a UTSW 15 100957579 missense probably damaging 1.00
R7479:Scn8a UTSW 15 100955477 missense probably damaging 0.99
X0066:Scn8a UTSW 15 101040080 missense probably damaging 1.00
X0066:Scn8a UTSW 15 101040081 missense probably damaging 1.00
Mode of Inheritance Autosomal Recessive
Local Stock Live Mice, Sperm
MMRRC Submission 038248-MU
Last Updated 2019-09-04 9:48 PM by Anne Murray
Record Created 2014-10-03 8:43 AM by Jeff SoRelle
Record Posted 2014-12-12
Phenotypic Description
Figure 1. Nymph mice exhibited decreased body weights.  Scaled weight data are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Video of the nymph neurological phenotype.

The nymph phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R0967, some of which exhibited decreased body weights when compensating for age and sex (Figure 1). These mice also had a mild tremor and an ataxic gait (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced body weight using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 40 mutations (X-axis) identified in the G1 male of pedigree R0967.  Scaled weight phenotype data are shown for single locus linkage analysis with consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 40 mutations. The decreased body weight was linked to a mutation in Scn8a: an A to G transition at base pair 101,035,646 (v38) on chromosome 15, or base pair 165,824 in the GenBank genomic region NC_000081.  Linkage was found with a recessive model of inheritance, wherein 4 homozygous variant mice departed phenotypically from 14 homozygous reference mice and 15 heterozygous mice with a P value of 1.051 x 10-5 (Figure 3). The mutation corresponds to residue 4,883 in the mRNA sequence NM_001077499 within exon 26 of 27 total exons. 

 

4867 TTTGCCTTGAGACACTACTATTTCACCATTGGC

1572 -F--A--L--R--H--Y--Y--F--T--I--G-

 

The mutated nucleotide is indicated in red.  The mutation results in a tyrosine (Y) to cysteine (C) substitution at amino acid 1577 (Y1577C) in the SCN8A protein, and is strongly predicted by Polyphen-2 to be probably damaging (score = 1.000).

Protein Prediction

Figure 4. A, Domain structure of SCN8A. B, Transmembrane organization of sodium channel subunits. Cylinders represent probable α-helical transmembrane segments (numbered 1-6 for each domain) with green cylinders indicating the pore-lining segments and yellow cylinders indicating the S4 voltage sensors (positively charged residues are represented by the + signs). The extracellular immunoglobulin-like domains of the β1 and β2 subunits are shown and a site of interaction between the  α and β1 subunit is indicated by the wavy, gray lines. Consensus phosphorylation sites are indicated by the orange circles. Purple circles represent the outer (EEDD) and inner (DEKA) rings of amino acid residues forming the ion selectivity filter and the TTX binding site. White circles indicate residues critical for fast inactivation. Binding sites for α- and β-scorpion toxins and anesthetic drugs are also shown. The residue affected by the nymph mutation is located in the cytoplasmic domain between the S2 and S3 helices of repeat IV. Image is interactive; click to see additional Scn8a‚Äč mutations.

Scn8a encodes the voltage-gated sodium channel SCN8A (alternatively, Nav1.6) (Figure 4). Voltage-gated sodium channels are essential for the initiation and propagation of action potentials in neurons and excitable cells by mediating the rapid influx of sodium. Nav1.6 contains four homologous domains (I-IV) that each consist of six transmembrane α-helices (S1-S6) (1;2). The S4 helices constitute the voltage sensors of the channel. A membrane reentrant extracellular loop (i.e., the pore loop) is located between S5 and S6 in each of the four domains and lines the extracellular, narrow entrance to the pore (3;4).  The S5 and S6 helices line the intracellular, wider exit of the pore, while amino acids (F1752 and Y1759) in in the S6 helix contribute to drug binding (5;6). The nymph mutation (Y1577C) is within the cytoplasmic domain between the S2 and S3 helices of repeat IV.

 

For more information about Scn8a, please see the record for TremorD.

Putative Mechanism

Mutations in Scn8a (e.g., Scn8amed, MGI:1856078; Scn8amed-tg, MGI:1856414; Scn8amed-J, MGI:1856079) lead to a range of neurological disorders in mice such as tremor, ataxia, early-onset progressive paralysis of the hind limbs, severe muscle atrophy, degeneration of Purkinje cells, and juvenile lethality (7). Loss of Scn8a expression in Scn8amed homozygous mice resulted in reduced conduction velocity of the sciatic nerve between postnatal day 17 and 23 and subsequent failure of transmission at the neuromuscular junction and muscle denervation (8-10). Reduced body weights (at all ages) have been observed in another Scn8a ENU mutant model, Scn8aClth (cloth-ears; MGI:3827095) mice (11).

Primers PCR Primer
nymph_pcr_F: TTCGTCACGCAACAAGCCTTCG
nymph_pcr_R: GCTCTCAGAAATCTGGTCCTCACAC

Sequencing Primer
nymph_seq_F: ACAAGCCTTCGACATCGTG
nymph_seq_R: TCCTCACACCTGGGGTC
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 418 nucleotides is amplified (chromosome 15, + strand):


1   ttcgtcacgc aacaagcctt cgacatcgtg atcatgatgc ttatctgcct taacatggtg
61  accatgatgg tggagacaga cacacagagc aagcagatgg agaacattct ctactggatt
121 aatctggtct tcgtcatctt cttcacctgc gagtgtgtgc tcaaaatgtt tgccttgaga
181 cactactatt tcaccattgg ctggaacatc tttgactttg tggtggtcat tctctccatt
241 gtgggtgagt gggtgcagcc acaggaaggg gggtgagtgg gcggggccac aggaagggtg
301 agtgggcggg gccacaggaa gagggggtga gtgggcgggg ccacgggaag aggggatgag
361 tgggcggggc cacaggaagg accaggaccc caggtgtgag gaccagattt ctgagagc


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

1. Burgess, D. L., Kohrman, D. C., Galt, J., Plummer, N. W., Jones, J. M., Spear, B., and Meisler, M. H. (1995) Mutation of a New Sodium Channel Gene, Scn8a, in the Mouse Mutant 'Motor Endplate Disease'. Nat Genet. 10, 461-465.

Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsJeff SoRelle, Zhe Chen, William McAlpine, Noelle Hutchins