Phenotypic Mutation 'patriot2' (pdf version)
Allelepatriot2
Mutation Type start codon destroyed
Chromosome11
Coordinate60,778,028 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Smcr8
Gene Name Smith-Magenis syndrome chromosome region, candidate 8 homolog (human)
Synonym(s) 2310076G09Rik, D030073L15Rik
Chromosomal Location 60,777,524-60,788,287 bp (+)
MGI Phenotype PHENOTYPE: Mouse embryonic fibroblasts homozygous for a knock-out allele show impaired autophagy induction, a reduced autophagic flux, and abnormal expression of lysosomal enzymes. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001085440 (variant 1), NM_175491 (variant 2); MGI:2444720

Mapped Yes 
Amino Acid Change Methionine changed to Valine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000002891] [ENSMUSP00000055926] [ENSMUSP00000099728] [ENSMUSP00000099729] [ENSMUSP00000113057] [ENSMUSP00000113653] [ENSMUSP00000115727]
SMART Domains Protein: ENSMUSP00000055926
Gene: ENSMUSG00000049323
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 78 262 5e-12 PFAM
Predicted Effect probably null

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000056907)
SMART Domains Protein: ENSMUSP00000099728
Gene: ENSMUSG00000049323
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
Pfam:Folliculin 87 255 8e-10 PFAM
Predicted Effect probably null

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000102667)
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (DSS Female) - decreased
Body Weight (Female) - decreased
DSS: sensitive day 10
DSS: sensitive day 7
FACS B1a cells in B1 cells - increased
FACS B220 MFI - increased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD4 T cells - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ CD8 T cells - increased
FACS CD44+ T cells - increased
FACS CD44+ T MFI - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS naive CD8 T cells in CD8 T cells - decreased
T-independent B cell response defect- increased TNP-specific IgM to TNP-Ficoll immunization
TLR signaling defect: hypersensitivity to CpG + IFNg
TLR signaling defect: TNF production by macrophages
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (other)(1) Gene trapped(5) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Smcr8 APN 11 60778632 unclassified probably null
IGL00514:Smcr8 APN 11 60778367 nonsense probably null
IGL01563:Smcr8 APN 11 60783845 missense possibly damaging 0.55
IGL01650:Smcr8 APN 11 60778184 missense probably damaging 1.00
IGL02390:Smcr8 APN 11 60779722 missense probably benign 0.03
IGL02582:Smcr8 APN 11 60778895 missense probably benign 0.00
IGL03008:Smcr8 APN 11 60778461 missense probably damaging 1.00
IGL03286:Smcr8 APN 11 60778027 unclassified probably benign
chauvenist UTSW 11 60778598 missense probably damaging 1.00
patriot UTSW 11 60778032 missense probably damaging 1.00
patriot3 UTSW 11 60779870 nonsense probably null
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0022:Smcr8 UTSW 11 60780359 missense probably damaging 1.00
R0197:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0333:Smcr8 UTSW 11 60780222 missense possibly damaging 0.96
R0346:Smcr8 UTSW 11 60779750 missense probably benign 0.00
R0701:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R0720:Smcr8 UTSW 11 60778443 missense probably damaging 1.00
R0883:Smcr8 UTSW 11 60778115 missense probably damaging 1.00
R1178:Smcr8 UTSW 11 60779532 missense probably damaging 1.00
R1418:Smcr8 UTSW 11 60778032 missense probably damaging 1.00
R2012:Smcr8 UTSW 11 60778184 missense probably damaging 1.00
R3690:Smcr8 UTSW 11 60778028 start codon destroyed probably null 1.00
R3767:Smcr8 UTSW 11 60779504 missense probably benign 0.30
R4801:Smcr8 UTSW 11 60778610 unclassified probably null
R4802:Smcr8 UTSW 11 60778610 unclassified probably null
R4862:Smcr8 UTSW 11 60778071 missense probably benign 0.01
R5108:Smcr8 UTSW 11 60779870 nonsense probably null
R5361:Smcr8 UTSW 11 60778292 missense probably damaging 1.00
R5745:Smcr8 UTSW 11 60784151 missense probably benign 0.00
R5806:Smcr8 UTSW 11 60780382 critical splice donor site probably null
R6041:Smcr8 UTSW 11 60779568 missense probably damaging 1.00
R6277:Smcr8 UTSW 11 60778809 missense probably benign 0.07
R6289:Smcr8 UTSW 11 60778598 missense probably damaging 1.00
R6445:Smcr8 UTSW 11 60779015 missense possibly damaging 0.95
R6826:Smcr8 UTSW 11 60778862 missense possibly damaging 0.85
Mode of Inheritance Autosomal Recessive
Local Stock gDNA
Repository
Last Updated 2019-01-07 9:40 AM by Anne Murray
Record Created 2015-11-16 6:33 AM by Tao Yue
Record Posted 2019-01-07
Phenotypic Description
Figure 1. Patriot2 mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Patriot2 mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Patriot2 mice exhibited increased TNFα secretion in response to TLR9 ligand, Cpg ODN, and priming with IFNg. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The patriot2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1418, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) after DSS exposure; weight loss is used to measure DSS susceptibility. Some mice also showed increased TNFα secretion in response to the TLR9 ligand CpG ODN (plus priming with IFNg) (Figure 3) (1).

Nature of Mutation
Figure 4. Linkage mapping of the TLR9 phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 93 mutations (X-axis) identified in the G1 male of pedigree R1418. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 93 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Smcr8: an A to G transition at base pair 60,778,028 (v38) on chromosome 11, or base pair 504 in the GenBank genomic region NC_000077 encoding Smcr8. The strongest association was found with a recessive model of inheritance to the TLR9 phenotype, wherein five variant homozygotes departed phenotypically from 11 homozygous reference mice and 18 heterozygous mice with a P value of 7.854 x 10-8 (Figure 4).  

 

The mutation corresponds to residue 504 in the mRNA sequence NM_001085440 within exon 1 of 2 total exons.

 

492 ATTTCAGGAAATATGATCAGCGCCCCTGAT

1               -M--I--S--A--P--D-

 

The mutated nucleotide is indicated in red. The mutation results in a methionine (M) to valine (V) substitution at position 1 (M1V) in the SMCR8 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999). The next methionine is at residue 95.

Protein Prediction
Figure 5. Domain organization of SMCR8. The patriot2 mutation results in a methionine to valine substitution at position 1. This image is interactive. Other mutations found in SMCR8 are noted in red. Click on each mutation for more information.

Smcr8 encodes SMCR8 (Smith-Magenis syndrome chromosome region, candidate 8). SMCR8 is a homolog of the DENN module, which is GDP-GTP exchange factor for Rab GTPases (2). The DENN module and SMCR8 both have an N-terminal longin (alternatively, u-DENN) domain, a DENN domain, and a d-DENN domain (Figure 5). The longin domain mediates interaction with GTPases (3) and has a PAS domain-like fold similar to ligand-binding domains (4).

 

The patriot2 mutation results in a methionine (M) to valine (V) substitution at position 1 (M1V) in the SMCR8 protein); amino acid 1 is within an undefined region of the SMCR8 protein.

 

Please see the record patriot for more information about Smcr8.

Putative Mechanism

SMCR8 interacts with C9ORF72 and WDR41 (see the record for gogi) to form the SWC (SMCR8-WDR41-C9ORF72) tripartite complex (5). The SWC complex functions as a GDP-GTP exchange factor for the small GTPases RAB8A and RAB39B, which function in vesicle trafficking and autophagy (6-10). After TBK1-mediated phosphorylation of SMCR8, the SWC complex interacts with the autophagy initiation complex ULK1/FIP200/autophagy-related protein 13 (ATG13)/ATG101 via C9ORF72 binding (6;7;9). The interaction between the SWC complex and the ULK1 complex regulates the expression and activity of ULK1 (9;10). Knockout of SMCR8 or C9ORF72 resulted in enlarged lysosome vesicles, while SMCR8 knockout alone showed accumulation of lysosomes and lysosomal enzymes as well as impaired autophagy induction (6-9;11). Mouse embryonic fibroblasts from Smcr8-deficient (Smcr8-/-) mice exhibited abnormal autophagy as well as a block in lysosomal degradation (MGI; accessed August 17, 2017).

 

Similar to patriot2 mice (see “Phenotypic Description”), Smcr8-/- and SMCR8-mutant (Smcr8I2T/I2T) showed increased TNF production in response to the TLR9 ligand CpG (1). The Smcr8-/- and Smcr8I2T/I2T mice also showed increased TNF responses and IL-6 production in response to stimulation with TLR7 and TLR3 ligands; TNF production was normal in response to TLR2 or TLR4 stimulation. Smcr8-/- and Smcr8I2T/I2T mice also showed splenomegaly and lymphadenopathy at 9 and 12 months of age (1). The mice showed normal numbers of macrophages, monocytes, neutrophils, B cells, and T cells in the peripheral blood; however, the percentages of naïve CD4+ and CD8+ T cells was reduced and the percentages of activated CD4+ and CD8+ T cells was increased (1). The mice also showed increased plasma levels of the cytokine IL-12p40 compared to wild-type mice (1). Smcr8-/- macrophages showed an accumulation of putative lysosomes. Similar to the patriot mice the Smcr8-/- and Smcr8I2T/I2T mice showed susceptibility to DSS treatment. Smcr8-/- mice also exhibited autoimmunity and increased lysosomal exocytosis in macrophages (5).

 

Loss of SMCR8 function results in aberrant activation of endosomal TLRs. The defects in TLR9-associated signaling observed in the patriot2 mice is proposed to be caused by defects in the SWC complex due to loss of SMCR8-assocated function (1). Loss of SWC complex function causes defects in lysosome and phagosome maturation, resulting in protracted TLR stimulation. The colitis phenotype observed in the patriot2 mice is putatively caused by defects in endosomal TLR signaling; the endosomal TLRs are required for protection in colitis.

Primers PCR Primer
patriot2(F):5'- CAGCTTTGGAGTTCATGAGGC -3'
patriot2(R):5'- GGATGAAGTCCCTGGAGAAC -3'

Sequencing Primer
patriot2_seq(F):5'- GTCCCAAACCTTGAGAGTCTG -3'
patriot2_seq(R):5'- GAACTTGGCCCCAGACAGTTTAG -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R36900041_PCR_F: 5’- CAGCTTTGGAGTTCATGAGGC-3’

R36900041_PCR_R: 5’- GGATGAAGTCCCTGGAGAAC-3’

 

Sequencing Primers

R36900041_SEQ_F: 5’- GTCCCAAACCTTGAGAGTCTG-3’
 

R36900041_SEQ_R: 5’- GAACTTGGCCCCAGACAGTTTAG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 401 nucleotides is amplified (NCBI RefSeq: NC_000077, chromosome 11):

 

  1 cagctttgga gttcatgagg cttgcccagg gcatcacagg tcccaaacct tgagagtctg

 61 cggcaattcg agttcttcgt tgtgtgacag ggcagtttag gatccccgga agtgcaaaga

121 aggccgcaag aacttcgttt tcgcatccag aggcctgact ctccctccga ccaaccctac

181 attattttcc atttcctctc aatgtgcttg ccatatttca ggaaatatga tcagcgcccc

241 tgatgtggtg gccttcacca aggaagatga atacgaggaa gaaccttaca atgagcccgc

301 tttgcctgag gagtactcag tccctctctt tccttatgcc agccaggggg caaacccctg

361 gtctaaactg tctggggcca agttctccag ggacttcatc c

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated A is shown in red text (Chr. + strand, A>G).

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsTao Yue, Emre Turer, William McAlpine, and Bruce Beutler