Phenotypic Mutation 'patriot2'

• Allele: patriot2
• Mutation Type: start codon destroyed
• Chromosome: 11
• Coordinate: 60,668,854 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Smcr8
• Gene Name: Smith-Magenis syndrome chromosome region, candidate 8 homolog (human)
• Synonym(s): 2310076G09Rik, D030073L15Rik
• Chromosomal Location: 60,668,351-60,679,113 bp (+) (GRCm39)
• MGI Phenotype: PHENOTYPE: Mouse embryonic fibroblasts homozygous for a knock-out allele show impaired autophagy induction, a reduced autophagic flux, and abnormal expression of lysosomal enzymes. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Methionine changed to Valine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000055926] [ENSMUSP00000099728]
• AlphaFold: Q3UMB5
• SMART Domains: Protein: ENSMUSP00000055926; Gene: ENSMUSG00000049323; AA Change: M1V

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
Pfam:Folliculin	78	262	5e-12	PFAM

• Predicted Effect: probably null ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000056907)
• SMART Domains: Protein: ENSMUSP00000099728; Gene: ENSMUSG00000049323; AA Change: M1V

Domain	Start	End	E-Value	Type
low complexity region	13	30	N/A	INTRINSIC
Pfam:Folliculin	87	255	8e-10	PFAM

• Predicted Effect: probably null ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000102667)
• Meta Mutation Damage Score: 0.9715
• Is this an essential gene?: Non Essential (E-score: 0.000)
• Phenotypic Category: Autosomal Recessive
• Mode of Inheritance: Autosomal Recessive
• Local Stock: gDNA
• Last Updated: 2019-01-07 9:40 AM by Anne Murray
• Record Created: 2015-11-16 6:33 AM by Tao Yue
• Record Posted: 2019-01-07
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Tao Yue, Emre Turer, William McAlpine, and Bruce Beutler

Accession Number

NCBI RefSeq: NM_001085440 (variant 1), NM_175491 (variant 2); MGI:2444720

Alleles Listed at MGI

All Mutations and Alleles(10) : Chemically induced (other)(1) Gene trapped(5) Targeted(4)

Phenotypic Description

Figure 1. Patriot2 mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Patriot2 mice exhibited susceptibility to dextran sodium sulfate (DSS)-induced colitis at 10 days after DSS treatment. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Patriot2 mice exhibited increased TNFα secretion in response to TLR9 ligand, Cpg ODN, and priming with IFNg. TNFα levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The patriot2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1418, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) after DSS exposure; weight loss is used to measure DSS susceptibility. Some mice also showed increased TNFα secretion in response to the TLR9 ligand CpG ODN (plus priming with IFNg) (Figure 3) (1).

Nature of Mutation

Figure 4. Linkage mapping of the TLR9 phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 93 mutations (X-axis) identified in the G1 male of pedigree R1418. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 93 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Smcr8: an A to G transition at base pair 60,778,028 (v38) on chromosome 11, or base pair 504 in the GenBank genomic region NC_000077 encoding Smcr8. The strongest association was found with a recessive model of inheritance to the TLR9 phenotype, wherein five variant homozygotes departed phenotypically from 11 homozygous reference mice and 18 heterozygous mice with a P value of 7.854 x 10^-8 (Figure 4).  

The mutation corresponds to residue 504 in the mRNA sequence NM_001085440 within exon 1 of 2 total exons.

492 ATTTCAGGAAATATGATCAGCGCCCCTGAT 1               -M--I--S--A--P--D-

The mutated nucleotide is indicated in red. The mutation results in a methionine (M) to valine (V) substitution at position 1 (M1V) in the SMCR8 protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.999). The next methionine is at residue 95.

Protein Prediction

Figure 5. Domain organization of SMCR8. The patriot2 mutation results in a methionine to valine substitution at position 1. This image is interactive. Other mutations found in SMCR8 are noted in red. Click on each mutation for more information.

Smcr8 encodes SMCR8 (Smith-Magenis syndrome chromosome region, candidate 8). SMCR8 is a homolog of the DENN module, which is GDP-GTP exchange factor for Rab GTPases (2). The DENN module and SMCR8 both have an N-terminal longin (alternatively, u-DENN) domain, a DENN domain, and a d-DENN domain (Figure 5). The longin domain mediates interaction with GTPases (3) and has a PAS domain-like fold similar to ligand-binding domains (4).

The patriot2 mutation results in a methionine (M) to valine (V) substitution at position 1 (M1V) in the SMCR8 protein); amino acid 1 is within an undefined region of the SMCR8 protein.

Please see the record patriot for more information about Smcr8.

Putative Mechanism

SMCR8 interacts with C9ORF72 and WDR41 (see the record for gogi) to form the SWC (SMCR8-WDR41-C9ORF72) tripartite complex (5). The SWC complex functions as a GDP-GTP exchange factor for the small GTPases RAB8A and RAB39B, which function in vesicle trafficking and autophagy (6-10). After TBK1-mediated phosphorylation of SMCR8, the SWC complex interacts with the autophagy initiation complex ULK1/FIP200/autophagy-related protein 13 (ATG13)/ATG101 via C9ORF72 binding (6;7;9). The interaction between the SWC complex and the ULK1 complex regulates the expression and activity of ULK1 (9;10). Knockout of SMCR8 or C9ORF72 resulted in enlarged lysosome vesicles, while SMCR8 knockout alone showed accumulation of lysosomes and lysosomal enzymes as well as impaired autophagy induction (6-9;11). Mouse embryonic fibroblasts from Smcr8-deficient (Smcr8^-/-) mice exhibited abnormal autophagy as well as a block in lysosomal degradation (MGI; accessed August 17, 2017).

Similar to patriot2 mice (see “Phenotypic Description”), Smcr8^-/- and SMCR8-mutant (Smcr8^I2T/I2T) showed increased TNF production in response to the TLR9 ligand CpG (1). The Smcr8^-/- and Smcr8^I2T/I2T mice also showed increased TNF responses and IL-6 production in response to stimulation with TLR7 and TLR3 ligands; TNF production was normal in response to TLR2 or TLR4 stimulation. Smcr8^-/- and Smcr8^I2T/I2T mice also showed splenomegaly and lymphadenopathy at 9 and 12 months of age (1). The mice showed normal numbers of macrophages, monocytes, neutrophils, B cells, and T cells in the peripheral blood; however, the percentages of naïve CD4+ and CD8+ T cells was reduced and the percentages of activated CD4+ and CD8+ T cells was increased (1). The mice also showed increased plasma levels of the cytokine IL-12p40 compared to wild-type mice (1). Smcr8^-/- macrophages showed an accumulation of putative lysosomes. Similar to the patriot mice the Smcr8^-/- and Smcr8^I2T/I2T mice showed susceptibility to DSS treatment. Smcr8^-/- mice also exhibited autoimmunity and increased lysosomal exocytosis in macrophages (5).

Loss of SMCR8 function results in aberrant activation of endosomal TLRs. The defects in TLR9-associated signaling observed in the patriot2 mice is proposed to be caused by defects in the SWC complex due to loss of SMCR8-assocated function (1). Loss of SWC complex function causes defects in lysosome and phagosome maturation, resulting in protracted TLR stimulation. The colitis phenotype observed in the patriot2 mice is putatively caused by defects in endosomal TLR signaling; the endosomal TLRs are required for protection in colitis.

Primers

PCR Primer
patriot2_pcr_F: CAGCTTTGGAGTTCATGAGGC
patriot2_pcr_R: GGATGAAGTCCCTGGAGAAC

Sequencing Primer
patriot2_seq_F: GTCCCAAACCTTGAGAGTCTG
patriot2_seq_R: GAACTTGGCCCCAGACAGTTTAG

Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R36900041_PCR_F: 5’- CAGCTTTGGAGTTCATGAGGC-3’

R36900041_PCR_R: 5’- GGATGAAGTCCCTGGAGAAC-3’

Sequencing Primers

R36900041_SEQ_F: 5’- GTCCCAAACCTTGAGAGTCTG-3’
 

R36900041_SEQ_R: 5’- GAACTTGGCCCCAGACAGTTTAG-3’
 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

The following sequence of 401 nucleotides is amplified (NCBI RefSeq: NC_000077, chromosome 11):

  1 cagctttgga gttcatgagg cttgcccagg gcatcacagg tcccaaacct tgagagtctg

 61 cggcaattcg agttcttcgt tgtgtgacag ggcagtttag gatccccgga agtgcaaaga

121 aggccgcaag aacttcgttt tcgcatccag aggcctgact ctccctccga ccaaccctac

181 attattttcc atttcctctc aatgtgcttg ccatatttca ggaaatatga tcagcgcccc

241 tgatgtggtg gccttcacca aggaagatga atacgaggaa gaaccttaca atgagcccgc

301 tttgcctgag gagtactcag tccctctctt tccttatgcc agccaggggg caaacccctg

361 gtctaaactg tctggggcca agttctccag ggacttcatc c

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated A is shown in red text (Chr. + strand, A>G).

References

  1. McAlpine, W., Sun, L., Wang, K. W., Liu, A., Jain, R., San Miguel, M., Wang, J., Zhang, Z., Hayse, B., McAlpine, S. G., Choi, J. H., Zhong, X., Ludwig, S., Russell, J., Zhan, X., Choi, M., Li, X., Tang, M., Moresco, E. M. Y., Beutler, B., and Turer, E. (2018) Excessive Endosomal TLR Signaling Causes Inflammatory Disease in Mice with Defective SMCR8-WDR41-C9ORF72 Complex Function. Proc Natl Acad Sci U S A. 115, E11523-E11531.

  2. Zhang, D., Iyer, L. M., He, F., and Aravind, L. (2012) Discovery of Novel DENN Proteins: Implications for the Evolution of Eukaryotic Intracellular Membrane Structures and Human Disease. Front Genet. 3, 283.

  3. Schlenker, O., Hendricks, A., Sinning, I., and Wild, K. (2006) The Structure of the Mammalian Signal Recognition Particle (SRP) Receptor as Prototype for the Interaction of Small GTPases with Longin Domains. J Biol Chem. 281, 8898-8906.

  4. Aravind, L., Mazumder, R., Vasudevan, S., and Koonin, E. V. (2002) Trends in Protein Evolution Inferred from Sequence and Structure Analysis. Curr Opin Struct Biol. 12, 392-399.

  5. Zhang, Y., Burberry, A., Wang, J. Y., Sandoe, J., Ghosh, S., Udeshi, N. D., Svinkina, T., Mordes, D. A., Mok, J., Charlton, M., Li, Q. Z., Carr, S. A., and Eggan, K. (2018) The C9orf72-Interacting Protein Smcr8 is a Negative Regulator of Autoimmunity and Lysosomal Exocytosis. Genes Dev. 32, 929-943.

  6. Sellier, C., Campanari, M. L., Julie Corbier, C., Gaucherot, A., Kolb-Cheynel, I., Oulad-Abdelghani, M., Ruffenach, F., Page, A., Ciura, S., Kabashi, E., and Charlet-Berguerand, N. (2016) Loss of C9ORF72 Impairs Autophagy and Synergizes with polyQ Ataxin-2 to Induce Motor Neuron Dysfunction and Cell Death. EMBO J. 35, 1276-1297.

  7. Sullivan, P. M., Zhou, X., Robins, A. M., Paushter, D. H., Kim, D., Smolka, M. B., and Hu, F. (2016) The ALS/FTLD Associated Protein C9orf72 Associates with SMCR8 and WDR41 to Regulate the Autophagy-Lysosome Pathway. Acta Neuropathol Commun. 4, 51-016-0324-5.

  8. Amick, J., Roczniak-Ferguson, A., and Ferguson, S. M. (2016) C9orf72 Binds SMCR8, Localizes to Lysosomes, and Regulates mTORC1 Signaling. Mol Biol Cell. 27, 3040-3051.

  9. Yang, M., Liang, C., Swaminathan, K., Herrlinger, S., Lai, F., Shiekhattar, R., and Chen, J. F. (2016) A C9ORF72/SMCR8-Containing Complex Regulates ULK1 and Plays a Dual Role in Autophagy. Sci Adv. 2, e1601167.

  10. Jung, J., Nayak, A., Schaeffer, V., Starzetz, T., Kirsch, A. K., Muller, S., Dikic, I., Mittelbronn, M., and Behrends, C. (2017) Multiplex Image-Based Autophagy RNAi Screening Identifies SMCR8 as ULK1 Kinase Activity and Gene Expression Regulator. Elife. 6, 10.7554/eLife.23063.

  11. Ugolino, J., Ji, Y. J., Conchina, K., Chu, J., Nirujogi, R. S., Pandey, A., Brady, N. R., Hamacher-Brady, A., and Wang, J. (2016) Loss of C9orf72 Enhances Autophagic Activity Via Deregulated mTOR and TFEB Signaling. PLoS Genet. 12, e1006443.