Phenotypic Mutation 'Cpg11' (pdf version)
AlleleCpg11
Mutation Type missense
Chromosome9
Coordinate106,224,586 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Tlr9
Gene Name toll-like receptor 9
Chromosomal Location 106,222,598-106,226,883 bp (+)
MGI Phenotype Mice homozygous for a knock-out allele exhibit impaired immune system response to LPS, CpG, and Leishmania bazillensis infection.
Accession Number

NCBI RefSeq: NM_031178; MGI: 1932389

Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceBeutler Lab
Ref Sequences
S359P in Ensembl: ENSMUSP00000082207 (fasta)
Gene Model not available
PDB Structure
Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
SMART Domains

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 363 386 N/A BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
Blast:LRR 471 494 N/A BLAST
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 N/A BLAST
Pfam:TIR 872 1012 1.1e-13 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using Ensembl: ENSMUSP00000082207)
Phenotypic Category TLR signaling defect: TNF production by macrophages
Penetrance unknown 
Alleles Listed at MGI

All alleles(9) : Targeted, knock-out(1) Gene trapped(1) Chemically induced(7)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.95
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
Cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 0.99
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
Cpg7 UTSW 9 106225349 missense probably benign 0.01
Meager UTSW 9 106224139 missense probably damaging 1.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0126:Tlr9 UTSW 9 106225682 missense probably benign 0.01
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.65
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 unclassified probably null
Mode of Inheritance Autosomal Semidominant
Local Stock Sperm, gDNA
MMRRC Submission 034329-JAX
Last Updated 05/13/2016 3:09 PM by Anne Murray
Record Created 04/20/2010 11:48 AM by Hua Huang
Record Posted 04/29/2010
Phenotypic Description

The CpG11 phenotype was identified in a screen for ENU-induced homozygous mutants with impaired responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from the index CpG11 mouse (G4562) produced normal amounts of tumor necrosis factor (TNF)-α in response to all TLR ligands tested, except oligodeoxynucleotides containing CpG motifs (CpG ODNs). CpG11 heterozygotes produced intermediate levels of TNF-α relative to wild type and CpG11 homozygotes, demonstrating that the mutation is semidominant (Figure 1).

Nature of Mutation
The candidate gene Tlr9 was sequenced directly, and a T to C transition was identified at position 1181, in exon 2 of 2 total exons.
1166 CTCCACCTGGCAAGTTCCTTTAAGAACCTGGTG
353  -L--H--L--A--S--S--F--K--N--L--V-
The mutated nucleotide is indicated in red lettering, and results in a serine to proline substitution at amino acid 359 of the TLR9 protein.
 
Please see the record for CpG1 for more information about Tlr9.
Protein Prediction
Figure 2. Protein and domain structure of TLR9. A) Schematic representation of TLR9 based on crystalized structures of mouse TLR9 LRR (PBD 3WPF) and human TLR2 TIR (1FYW) domains. The residue affected by the CpG11 mutation is shown in red. 3D image was created using UCSF Chimera. B) TLR9 is a 1032 amino acid protein with an extracellur domain (pink) of leucine rich repeats (LRR), a short transmembrane domain and an cytoplasmic Toll/Interleukin-1 receptor (TIR) domain. The CpG11 mutation (red asterisk) results in a serine to proline substitution at amino acid 359 of the TLR9 protein in the predicted eleventh leucine rich repeat (LRR). This image is interactive. Click on the image to view other mutations found in TLR9 (red). Click on the mutations for more specific information.

The extracellular domains of TLRs contain multiple leucine rich repeats (LRRs) that mediate ligand recognition by TLRs. TLR9 has 25 LRRs in its ectodomain. The CpG11 mutation is located in the predicted eleventh leucine rich repeat (LRR) of the TLR9 ectodomain (Figure 2).

Putative Mechanism

Based on the 3D structures of TLR1, TLR2 (1), TLR3 (2-4), and other LRR-containing proteins (5), the serine mutated in CpG11 is predicted to lie in the surface-exposed α-helical second leucine-rich sequence of the affected LRR, at a position thought to permit occupancy by any amino acid, but adjacent to an invariant phenylalanine. The CpG11 phenotype indicates that a proline at this position fails to support normal function of TLR9. The mutation may disrupt ligand binding, receptor dimerization, or destroy proper folding or localization of the receptor.

Primers Primers cannot be located by automatic search.
Genotyping
CpG11 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide insertion.
 
Primers
CpG11 (F): 5’- CATGGACGGGAACTGCTACTACAAG -3’
CpG11(R): 5’-ATGAAGTTCTTAGAAGCAGGGGTGC -3’
 
PCR program
1) 95°C             2:00
2) 95°C             0:30
3) 56°C             0:30
4) 72°C             1:00
5) repeat steps (2-4) 29X
6) 72°C             7:00
7) 4°C              ∞
 
Primers for sequencing
CpG11_seq(F): 5’- TGAGCAATCTCACCCATCTG -3’
CpG11_seq(R): 5’- GACAACAGCTCCTCCTGCTC -3’
 
The following sequence of 885 nucleotides (from Genbank genomic region NC_­­­­­000075 for linear genomic sequence of Tlr9, sense strand) is amplified:
 
1433                                                          catggacg
1441 ggaactgcta ctacaagaac ccctgcacag gagcggtgaa ggtgacccca ggcgccctcc
1501 tgggcctgag caatctcacc catctgtctc tgaagtataa caacctcaca aaggtgcccc
1561 gccaactgcc ccccagcctg gagtacctcc tggtgtccta taacctcatt gtcaagctgg
1621 ggcctgaaga cctggccaat ctgacctccc ttcgagtact tgatgtgggt gggaattgcc
1681 gtcgctgtga ccatgccccc aatccctgta tagaatgtgg ccaaaagtcc ctccacctgc
1741 accctgagac cttccatcac ctgagccatc tggaaggcct ggtgctgaag gacagctctc
1801 tccatacact gaactcttcc tggttccaag gtctggtcaa cctctcggtg ctggacctaa
1861 gcgagaactt tctctatgaa agcatcaccc acaccaatgc ctttcagaac ctaacccgcc
1921 tgcgcaagct caacctgtcc ttcaattacc gcaagaaggt atcctttgcc cgcctccacc
1981 tggcaagttc ctttaagaac ctggtgtcac tgcaggagct gaacatgaac ggcatcttct
2041 tccgcttgct caacaagtac acgctcagat ggctggccga tctgcccaaa ctccacactc
2101 tgcatcttca aatgaacttc atcaaccagg cacagctcag catctttggt accttccgag
2161 cccttcgctt tgtggacttg tcagacaatc gcatcagtgg gccttcaacg ctgtcagaag
2221 ccacccctga agaggcagat gatgcagagc aggaggagct gttgtctgcg gatcctcacc
2281 cagctccgct gagcacccct gcttctaaga acttcat
 
Primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated T is indicated in red.
References
Science Writers Eva Marie Y. Moresco
Illustrators Diantha La Vine
AuthorsHua Huang, Bruce Beutler
Edit History
01/31/2011 8:38 AM (current)
01/31/2011 8:38 AM
01/21/2011 3:11 PM
01/07/2011 7:34 AM
01/06/2011 12:18 PM
12/08/2010 3:31 PM
11/10/2010 5:06 PM
10/19/2010 1:28 PM
08/06/2010 10:08 AM
06/23/2010 10:55 AM
06/23/2010 10:09 AM
06/22/2010 1:26 PM
06/22/2010 1:20 PM
06/16/2010 1:05 PM
04/29/2010 12:02 PM
04/29/2010 12:00 PM
04/29/2010 11:52 AM
04/29/2010 11:52 AM
04/29/2010 11:51 AM