Incidental Mutation 'R1148:Dars'
List |< first << previous [record 63 of 291] next >> last >|
ID165185
Institutional Source Beutler Lab
Gene Symbol Dars
Ensembl Gene ENSMUSG00000026356
Gene Nameaspartyl-tRNA synthetase
Synonyms5730439G15Rik
MMRRC Submission 039221-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R1148 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128363707-128417368 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 128366909 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027602]
Predicted Effect probably benign
Transcript: ENSMUST00000027602
SMART Domains Protein: ENSMUSP00000027602
Gene: ENSMUSG00000026356

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 60 145 4.6e-10 PFAM
Pfam:tRNA-synt_2 175 496 2.3e-77 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a multienzyme complex that functions in mediating the attachment of amino acids to their cognate tRNAs. The encoded protein ligates L-aspartate to tRNA(Asp). Mutations in this gene have been found in patients showing hypomyelination with brainstem and spinal cord involvement and leg spasticity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele die between E11 and E14. Mice heterozygous for the allele exhibit decreased PPI. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T C 11: 58,876,718 S14P probably damaging Het
Ablim2 T C 5: 35,809,261 F178S probably damaging Het
AC149051.1 A G 8: 63,926,855 L981P probably damaging Het
Alg10b T C 15: 90,227,865 F304S possibly damaging Het
Ank3 C T 10: 69,882,539 S540F probably damaging Het
Arhgef16 T C 4: 154,280,889 N590D probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bbs9 T C 9: 22,575,100 probably benign Het
Cfap58 C T 19: 47,988,504 H731Y probably damaging Het
Cilp T A 9: 65,280,316 L1231Q possibly damaging Het
Coq8a G A 1: 180,169,403 probably benign Het
Cyp4x1 A G 4: 115,126,555 probably benign Het
Disp2 G A 2: 118,806,418 probably null Het
Dnah5 T C 15: 28,421,690 L3896P probably damaging Het
Dpp8 T C 9: 65,053,832 probably null Het
Esp4 A C 17: 40,602,371 N43T probably benign Het
Fat3 T C 9: 15,996,774 D2644G probably damaging Het
Fgd5 A G 6: 91,987,631 K124E probably benign Het
Folh1 T C 7: 86,761,730 D268G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Homo
Hexdc A G 11: 121,221,267 I438V probably benign Het
Lonp2 A G 8: 86,636,540 E262G probably benign Het
Ly6h G T 15: 75,565,172 S118R unknown Het
Mapk12 T C 15: 89,134,623 Y203C probably damaging Het
Mapk15 A G 15: 75,998,155 T375A probably benign Het
Morc2a A G 11: 3,678,557 N337D probably benign Het
Nsd3 A G 8: 25,713,380 D1307G probably benign Het
Olfr1009 C A 2: 85,722,276 Y290* probably null Het
Osbpl11 T C 16: 33,227,212 F515S probably damaging Het
Pcdh15 T C 10: 74,170,560 V90A probably damaging Het
Ptpn4 T A 1: 119,675,709 probably benign Het
Ptpn4 T C 1: 119,684,540 D41G probably damaging Het
Rbm4b A G 19: 4,757,499 H81R probably damaging Het
Ric1 T C 19: 29,579,849 Y445H probably benign Het
Sez6l2 C A 7: 126,961,812 P483Q probably damaging Het
Sh3d19 A G 3: 86,107,327 D475G possibly damaging Het
Shprh T C 10: 11,213,482 S1655P possibly damaging Het
Slc25a12 G A 2: 71,312,568 probably benign Het
Strc A G 2: 121,372,077 probably benign Het
Trp53rka C A 2: 165,493,041 probably benign Het
Ttc22 G A 4: 106,623,031 V161M probably damaging Het
Unc79 T C 12: 103,112,667 L1504P probably damaging Het
Vldlr A G 19: 27,241,291 N514S probably benign Het
Wnk1 A G 6: 119,952,006 probably benign Het
Wsb2 T C 5: 117,370,677 probably benign Het
Other mutations in Dars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Dars APN 1 128415344 splice site probably benign
IGL02260:Dars APN 1 128372161 missense probably benign 0.19
IGL03264:Dars APN 1 128413690 missense probably damaging 1.00
R0308:Dars UTSW 1 128364259 missense probably damaging 1.00
R0609:Dars UTSW 1 128405381 missense probably benign 0.00
R1598:Dars UTSW 1 128373972 missense probably benign 0.00
R2092:Dars UTSW 1 128374018 missense probably damaging 1.00
R2140:Dars UTSW 1 128372162 missense probably benign 0.00
R2196:Dars UTSW 1 128378858 missense probably damaging 1.00
R4735:Dars UTSW 1 128376234 nonsense probably null
R5294:Dars UTSW 1 128364302 missense probably benign 0.02
R5521:Dars UTSW 1 128373973 missense probably benign 0.01
R6137:Dars UTSW 1 128368439 missense probably benign 0.44
R6784:Dars UTSW 1 128391347 missense probably damaging 1.00
R6899:Dars UTSW 1 128413746 missense possibly damaging 0.83
Predicted Primers
Posted On2014-03-28