Incidental Mutation 'R6137:Dars'
ID488382
Institutional Source Beutler Lab
Gene Symbol Dars
Ensembl Gene ENSMUSG00000026356
Gene Nameaspartyl-tRNA synthetase
Synonyms5730439G15Rik
MMRRC Submission 044284-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R6137 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location128363707-128417368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128368439 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 386 (T386A)
Ref Sequence ENSEMBL: ENSMUSP00000027602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027602]
Predicted Effect probably benign
Transcript: ENSMUST00000027602
AA Change: T386A

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027602
Gene: ENSMUSG00000026356
AA Change: T386A

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 60 145 4.6e-10 PFAM
Pfam:tRNA-synt_2 175 496 2.3e-77 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a multienzyme complex that functions in mediating the attachment of amino acids to their cognate tRNAs. The encoded protein ligates L-aspartate to tRNA(Asp). Mutations in this gene have been found in patients showing hypomyelination with brainstem and spinal cord involvement and leg spasticity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele die between E11 and E14. Mice heterozygous for the allele exhibit decreased PPI. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700092M07Rik A T 19: 8,740,784 D6V probably damaging Het
2310057M21Rik G T 7: 131,357,613 H165Q probably damaging Het
Akap13 T A 7: 75,677,416 F721Y probably damaging Het
Akap6 A T 12: 53,140,354 D1517V probably damaging Het
Amigo3 T A 9: 108,053,728 S117T probably damaging Het
Atf7ip2 T A 16: 10,201,411 N34K probably damaging Het
Cacnb1 A C 11: 98,005,782 V351G probably damaging Het
Casp9 T A 4: 141,805,349 probably null Het
Ccdc51 C T 9: 109,089,415 T24I probably benign Het
Cdh23 T A 10: 60,434,512 Y618F probably damaging Het
Chd1 T A 17: 15,758,688 W1271R probably damaging Het
Dchs1 T A 7: 105,765,106 D834V probably damaging Het
Dgkd T A 1: 87,936,381 V933E possibly damaging Het
Dnah17 A G 11: 118,025,654 F4203S probably damaging Het
Fancm T C 12: 65,130,382 L2000P probably damaging Het
Fbxo11 A T 17: 88,008,669 H444Q probably benign Het
Fbxw14 T A 9: 109,276,222 T292S probably damaging Het
Fer1l6 T C 15: 58,559,206 S237P probably damaging Het
Frem3 T C 8: 80,615,047 I1323T probably benign Het
Grin2a A G 16: 9,653,449 F652L probably benign Het
Grin2b T A 6: 135,923,458 M142L possibly damaging Het
Helz A G 11: 107,619,060 Q503R possibly damaging Het
Ighv5-17 A G 12: 113,859,295 Y69H probably benign Het
Il17ra A G 6: 120,475,582 N242S probably benign Het
Immp1l G C 2: 105,964,208 G117A probably damaging Het
Itm2c T C 1: 85,894,692 V10A probably benign Het
Kif1b T C 4: 149,238,426 K679E possibly damaging Het
Kng1 T C 16: 23,074,645 V256A possibly damaging Het
Lamc2 T G 1: 153,166,153 R78S possibly damaging Het
Loxl4 A G 19: 42,598,793 F621S probably damaging Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lypd3 T C 7: 24,640,494 Y329H probably benign Het
Mettl13 T C 1: 162,535,886 D225G probably benign Het
Myo7b A G 18: 31,999,974 F441L probably damaging Het
Nnt T A 13: 119,336,328 M699L possibly damaging Het
Nr1h3 A T 2: 91,191,851 M144K probably damaging Het
Olfr1040 A G 2: 86,145,969 V255A probably benign Het
Olfr1347 T C 7: 6,488,845 T3A probably benign Het
Olfr325 A T 11: 58,581,068 M75L probably benign Het
Pappa2 A T 1: 158,871,543 Y667N probably damaging Het
Prps1l3 A G 12: 57,238,888 I155V probably benign Het
Ptgs2 T A 1: 150,100,993 N24K probably benign Het
Ralgds A T 2: 28,547,588 M514L probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Sacm1l T A 9: 123,569,005 V254D probably damaging Het
Selenot A T 3: 58,585,284 Q64L probably damaging Het
Sgsm2 G A 11: 74,850,851 R1037W probably damaging Het
Slc22a12 A G 19: 6,542,724 V10A probably benign Het
Spem2 G T 11: 69,816,696 S481* probably null Het
Styk1 C T 6: 131,311,016 G128D probably damaging Het
Tmc6 A T 11: 117,776,328 L148Q probably damaging Het
Tmem138 A C 19: 10,574,835 probably null Het
Tnpo3 A G 6: 29,555,268 V772A probably benign Het
Topaz1 T C 9: 122,797,756 F1483S possibly damaging Het
Tuba4a C A 1: 75,216,055 C305F probably damaging Het
Ubap1 T G 4: 41,379,262 F159V possibly damaging Het
Vmn2r9 A G 5: 108,849,016 I129T probably benign Het
Wwc2 A T 8: 47,856,263 M828K unknown Het
Zfp236 A T 18: 82,671,794 S187T possibly damaging Het
Other mutations in Dars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Dars APN 1 128415344 splice site probably benign
IGL02260:Dars APN 1 128372161 missense probably benign 0.19
IGL03264:Dars APN 1 128413690 missense probably damaging 1.00
R0308:Dars UTSW 1 128364259 missense probably damaging 1.00
R0609:Dars UTSW 1 128405381 missense probably benign 0.00
R1148:Dars UTSW 1 128366909 splice site probably benign
R1598:Dars UTSW 1 128373972 missense probably benign 0.00
R2092:Dars UTSW 1 128374018 missense probably damaging 1.00
R2140:Dars UTSW 1 128372162 missense probably benign 0.00
R2196:Dars UTSW 1 128378858 missense probably damaging 1.00
R4735:Dars UTSW 1 128376234 nonsense probably null
R5294:Dars UTSW 1 128364302 missense probably benign 0.02
R5521:Dars UTSW 1 128373973 missense probably benign 0.01
R6784:Dars UTSW 1 128391347 missense probably damaging 1.00
R6899:Dars UTSW 1 128413746 missense possibly damaging 0.83
R7284:Dars UTSW 1 128372267 missense probably benign
R7437:Dars UTSW 1 128372204 missense possibly damaging 0.46
R7562:Dars UTSW 1 128367026 missense possibly damaging 0.86
R8169:Dars UTSW 1 128376265 missense probably null
R8223:Dars UTSW 1 128372224 missense probably benign 0.06
Z1176:Dars UTSW 1 128372207 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCCATCCCAGTAAGTCCTTAG -3'
(R):5'- CTAAAGGGTGTGGCATCAGG -3'

Sequencing Primer
(F):5'- AGAGAGTTCTCTTTCTTCCC -3'
(R):5'- ACTTCAGTCGTTTCCATTTGAAG -3'
Posted On2017-10-10