Incidental Mutation 'R2130:Tnnt2'
ID227907
Institutional Source Beutler Lab
Gene Symbol Tnnt2
Ensembl Gene ENSMUSG00000026414
Gene Nametroponin T2, cardiac
SynonymscTnT, Tnt, cardiac TnT
MMRRC Submission 040133-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2130 (G1)
Quality Score217
Status Validated
Chromosome1
Chromosomal Location135836354-135852260 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) TG to TGG at 135846761 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027671] [ENSMUST00000112085] [ENSMUST00000112086] [ENSMUST00000112087] [ENSMUST00000178204] [ENSMUST00000178854] [ENSMUST00000179863] [ENSMUST00000188028] [ENSMUST00000189355] [ENSMUST00000189732] [ENSMUST00000189826] [ENSMUST00000190451]
Predicted Effect probably benign
Transcript: ENSMUST00000027671
SMART Domains Protein: ENSMUSP00000027671
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 234 1e-33 PFAM
Pfam:Troponin 226 289 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112085
SMART Domains Protein: ENSMUSP00000107715
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
low complexity region 20 54 N/A INTRINSIC
Pfam:Troponin 100 238 2.4e-33 PFAM
Pfam:Troponin 230 293 2.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112086
SMART Domains Protein: ENSMUSP00000107716
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
low complexity region 3 58 N/A INTRINSIC
Pfam:Troponin 106 244 2.5e-33 PFAM
Pfam:Troponin 236 299 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112087
SMART Domains Protein: ENSMUSP00000107717
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
Pfam:Troponin 106 250 1.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178204
SMART Domains Protein: ENSMUSP00000137579
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 38 N/A INTRINSIC
Pfam:Troponin 110 245 3.8e-34 PFAM
Pfam:Troponin 238 300 4.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178854
SMART Domains Protein: ENSMUSP00000136265
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179863
SMART Domains Protein: ENSMUSP00000137093
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186225
Predicted Effect probably benign
Transcript: ENSMUST00000188028
SMART Domains Protein: ENSMUSP00000140941
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 251 3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188098
Predicted Effect probably benign
Transcript: ENSMUST00000189355
SMART Domains Protein: ENSMUSP00000139919
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Pfam:Troponin 96 240 1.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189732
SMART Domains Protein: ENSMUSP00000139669
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
Pfam:Troponin 100 244 1.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189826
SMART Domains Protein: ENSMUSP00000140807
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
Pfam:Troponin 110 201 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190451
SMART Domains Protein: ENSMUSP00000140282
Gene: ENSMUSG00000026414

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
PDB:2Z5H|T 85 114 3e-7 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during and prior to organogenesis and abnormal heart development. Mice homozygous for an allele that lacks the lysine residue at position 210 exhibit dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Adgrl2 T C 3: 148,890,488 I71V probably damaging Het
Adgrv1 T C 13: 81,581,727 T212A possibly damaging Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Apaf1 A T 10: 91,060,165 Y348* probably null Het
Apobr A G 7: 126,587,206 T630A probably benign Het
Arhgap23 A G 11: 97,451,561 D223G possibly damaging Het
Asic1 A T 15: 99,671,875 T26S possibly damaging Het
Atp13a2 T A 4: 141,005,016 M864K probably damaging Het
Atrnl1 G A 19: 57,654,994 G438D probably damaging Het
Bbc3 T C 7: 16,312,343 V68A possibly damaging Het
Birc6 T C 17: 74,659,154 probably benign Het
Btnl9 A G 11: 49,180,696 F100S probably damaging Het
Ccpg1 A G 9: 73,013,158 N685S probably damaging Het
Ces3b T A 8: 105,092,975 probably null Het
Cfhr2 T G 1: 139,831,155 R52S probably benign Het
Clhc1 A G 11: 29,557,663 I126V probably benign Het
Crocc T C 4: 141,029,102 I1071V probably benign Het
Dbt T A 3: 116,539,124 D16E probably damaging Het
Dnajc8 T C 4: 132,544,059 S62P possibly damaging Het
Dpyd T C 3: 118,674,568 V77A probably benign Het
Dram2 T A 3: 106,570,760 M136K possibly damaging Het
Dtx2 T A 5: 136,012,040 F100I probably damaging Het
Dync2h1 A T 9: 7,011,253 W3654R probably damaging Het
Fam129b A G 2: 32,923,647 K624R probably benign Het
Fam208a T A 14: 27,446,388 Y296N probably damaging Het
Fam208a A G 14: 27,476,614 N1301S possibly damaging Het
Fbxw10 T A 11: 62,859,857 I422N probably damaging Het
Fgf17 T C 14: 70,638,487 R102G probably damaging Het
Gatsl2 G A 5: 134,136,153 C187Y probably damaging Het
Gm28040 AGTG AGTGGCACCTTTGGTG 1: 133,327,321 probably benign Het
Gm6578 C A 6: 12,100,187 noncoding transcript Het
Gm8298 T C 3: 59,865,348 V91A probably damaging Het
Gm8374 T C 14: 7,364,194 T49A probably damaging Het
Gm9797 G T 10: 11,609,369 noncoding transcript Het
Golga3 T C 5: 110,202,939 probably null Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Igfn1 AGGG AGG 1: 135,974,852 probably benign Het
Insrr G A 3: 87,810,572 probably null Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,386,268 probably benign Het
Ipo9 A G 1: 135,402,250 V484A probably benign Het
Isoc2b A T 7: 4,851,439 I31N probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Krtap16-1 A T 11: 99,985,776 C267* probably null Het
Lamc2 T A 1: 153,127,124 D1037V probably damaging Het
Lhfpl2 A G 13: 94,192,049 D206G possibly damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Mgat2 T C 12: 69,185,294 F214S probably damaging Het
Mki67 T A 7: 135,704,241 probably null Het
Mpo A G 11: 87,797,361 D282G possibly damaging Het
Myh10 A G 11: 68,807,289 probably benign Het
Myo15b G A 11: 115,871,643 V1229I probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Olfml3 T A 3: 103,735,869 M399L probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr453 C A 6: 42,744,135 L33M possibly damaging Het
Olfr683 T A 7: 105,143,550 I254F probably benign Het
Optc A T 1: 133,903,796 probably null Het
Plekha6 C A 1: 133,279,365 probably null Het
Prelp C T 1: 133,915,131 R92K probably benign Het
Psph T A 5: 129,787,539 probably null Het
Ptpro A G 6: 137,411,116 probably null Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,448,417 probably benign Het
Ren1 C G 1: 133,350,778 probably null Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Rnf17 T C 14: 56,493,354 V1205A probably damaging Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Sgo2b T C 8: 63,927,147 R884G probably benign Het
Slc10a5 G T 3: 10,335,218 D127E probably benign Het
Slc25a35 T G 11: 68,968,965 S101R possibly damaging Het
Slc6a13 T C 6: 121,325,041 L194P possibly damaging Het
Snw1 T G 12: 87,452,703 probably benign Het
Sort1 T A 3: 108,351,686 F678Y probably benign Het
Srsf12 C T 4: 33,225,764 probably benign Het
Ssxa1 T A X: 21,119,342 probably benign Het
Stard13 T C 5: 151,045,168 Y879C probably damaging Het
Syt2 ACTCTCTCT ACTCTCTCTCT 1: 134,746,741 probably benign Het
Tacr3 T C 3: 134,932,180 V366A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tkfc A G 19: 10,596,041 I279T probably damaging Het
Tmem98 A G 11: 80,817,522 E106G probably damaging Het
Trim41 C A 11: 48,807,592 G516W probably damaging Het
Trove2 T C 1: 143,760,034 D458G probably benign Het
Ttn T C 2: 76,742,517 T24265A possibly damaging Het
Usp37 A G 1: 74,461,656 V582A probably damaging Het
Vps13b T A 15: 35,671,400 I1683N probably benign Het
Vps13d C T 4: 145,156,101 R968H probably benign Het
Vwf C T 6: 125,657,057 T166I probably damaging Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp459 A T 13: 67,408,276 H229Q probably benign Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Zmynd19 T A 2: 24,952,636 Y15* probably null Het
Other mutations in Tnnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Tnnt2 APN 1 135851702 missense probably damaging 1.00
IGL00885:Tnnt2 APN 1 135846764 splice site probably benign
IGL02223:Tnnt2 APN 1 135842015 intron probably benign
IGL03094:Tnnt2 APN 1 135849462 critical splice donor site probably null
R0827:Tnnt2 UTSW 1 135843796 intron probably benign
R1469:Tnnt2 UTSW 1 135852055 missense possibly damaging 0.83
R1469:Tnnt2 UTSW 1 135852055 missense possibly damaging 0.83
R1478:Tnnt2 UTSW 1 135848026 missense probably benign 0.40
R1728:Tnnt2 UTSW 1 135845506 intron probably benign
R1729:Tnnt2 UTSW 1 135845506 intron probably benign
R1730:Tnnt2 UTSW 1 135845506 intron probably benign
R1739:Tnnt2 UTSW 1 135845506 intron probably benign
R1762:Tnnt2 UTSW 1 135845506 intron probably benign
R1783:Tnnt2 UTSW 1 135845506 intron probably benign
R1784:Tnnt2 UTSW 1 135845506 intron probably benign
R1785:Tnnt2 UTSW 1 135845506 intron probably benign
R1891:Tnnt2 UTSW 1 135840859 critical splice acceptor site probably null
R2049:Tnnt2 UTSW 1 135846761 splice site probably benign
R2104:Tnnt2 UTSW 1 135843809 intron probably benign
R2141:Tnnt2 UTSW 1 135846761 splice site probably benign
R2225:Tnnt2 UTSW 1 135843791 intron probably benign
R2227:Tnnt2 UTSW 1 135843791 intron probably benign
R2504:Tnnt2 UTSW 1 135852065 missense probably damaging 0.96
R4883:Tnnt2 UTSW 1 135847758 nonsense probably null
R5963:Tnnt2 UTSW 1 135843862 intron probably benign
R6082:Tnnt2 UTSW 1 135849434 missense probably benign 0.30
R6261:Tnnt2 UTSW 1 135850554 intron probably null
R7208:Tnnt2 UTSW 1 135850376 splice site probably null
R7241:Tnnt2 UTSW 1 135851706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGTCACCTTCATGCTTG -3'
(R):5'- TAATTGGTAGTGAAGTCAAGGCGAC -3'

Sequencing Primer
(F):5'- CACCTTCATGCTTGTTGGTG -3'
(R):5'- TCAAGGCGACGTTCAGCTC -3'
Posted On2014-09-17