Incidental Mutation 'R2761:Cpa2'
ID 254040
Institutional Source Beutler Lab
Gene Symbol Cpa2
Ensembl Gene ENSMUSG00000071553
Gene Name carboxypeptidase A2, pancreatic
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2761 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 30541582-30564476 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30554194 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000093771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096066]
AlphaFold Q504N0
Predicted Effect probably damaging
Transcript: ENSMUST00000096066
AA Change: D271G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093771
Gene: ENSMUSG00000071553
AA Change: D271G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Propep_M14 26 100 3.5e-25 PFAM
Zn_pept 121 400 3.4e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146936
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases. The encoded preproprotein undergoes proteolytic processing that removes the N-terminal activation peptide to generate a functional enzyme. This gene is expressed by the pancreatic exocrine cells which secrete the enzyme during digestion. This gene is located in a cluster of carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,067,780 V910A probably damaging Het
1700123K08Rik T C 5: 138,564,174 T102A possibly damaging Het
Acoxl T C 2: 127,877,813 Y165H probably benign Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Cdh1 T A 8: 106,653,849 I208N possibly damaging Het
Col11a2 A G 17: 34,051,026 I477V probably damaging Het
Dzank1 T C 2: 144,513,449 M109V probably benign Het
Hdac3 A T 18: 37,945,726 S111T probably benign Het
Kremen1 GGG GGGTGG 11: 5,201,792 probably benign Het
Krt31 T C 11: 100,047,865 T301A probably benign Het
Rad21 T A 15: 51,982,643 K10N probably damaging Het
Snap47 T C 11: 59,438,059 D139G probably benign Het
Tango6 C A 8: 106,699,032 T408N possibly damaging Het
Other mutations in Cpa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cpa2 APN 6 30564412 missense probably benign 0.03
IGL01832:Cpa2 APN 6 30551999 missense probably benign
IGL02233:Cpa2 APN 6 30557667 splice site probably benign
IGL02534:Cpa2 APN 6 30550768 missense probably benign 0.20
IGL03057:Cpa2 APN 6 30557727 missense probably damaging 1.00
R0931:Cpa2 UTSW 6 30552071 splice site probably benign
R1442:Cpa2 UTSW 6 30544866 splice site probably null
R1664:Cpa2 UTSW 6 30554315 missense probably damaging 0.98
R1752:Cpa2 UTSW 6 30552024 missense probably damaging 1.00
R4535:Cpa2 UTSW 6 30552021 missense probably benign 0.19
R4913:Cpa2 UTSW 6 30554293 missense probably damaging 1.00
R5256:Cpa2 UTSW 6 30547197 missense probably damaging 0.96
R5461:Cpa2 UTSW 6 30544181 missense probably benign 0.03
R5630:Cpa2 UTSW 6 30550732 splice site probably null
R6629:Cpa2 UTSW 6 30554194 missense probably damaging 0.99
R7368:Cpa2 UTSW 6 30551990 missense probably damaging 1.00
R8140:Cpa2 UTSW 6 30544905 missense probably benign 0.10
R8163:Cpa2 UTSW 6 30564351 missense probably damaging 1.00
R8165:Cpa2 UTSW 6 30564346 missense probably benign 0.00
R8877:Cpa2 UTSW 6 30541693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAACTAACATCCACCCTGC -3'
(R):5'- TCACCAGCTCATTAAAGTCATCTG -3'

Sequencing Primer
(F):5'- ACTCACTTTGTAGATTAGGCAGGCC -3'
(R):5'- AAAGTCATCTGGCTTGGCAC -3'
Posted On 2014-12-04