Incidental Mutation 'P4748:Tmed4'
ID26546
Institutional Source Beutler Lab
Gene Symbol Tmed4
Ensembl Gene ENSMUSG00000004394
Gene Nametransmembrane p24 trafficking protein 4
Synonyms1110014L17Rik
Accession Numbers

Genbank: NM_134020; MGI: 1915070

Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #P4748 () of strain 712
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location6270369-6274870 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 6273727 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004508] [ENSMUST00000132147]
Predicted Effect probably benign
Transcript: ENSMUST00000004508
SMART Domains Protein: ENSMUSP00000004508
Gene: ENSMUSG00000004394

DomainStartEndE-ValueType
EMP24_GP25L 29 222 3.21e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130621
Predicted Effect probably benign
Transcript: ENSMUST00000132147
SMART Domains Protein: ENSMUSP00000121643
Gene: ENSMUSG00000004394

DomainStartEndE-ValueType
EMP24_GP25L 29 170 3.3e-26 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.5%
  • 20x: 94.5%
Validation Efficiency 87% (26/30)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,295,159 probably benign Het
4930556J24Rik A T 11: 3,938,178 probably null Het
Acoxl T C 2: 128,086,344 probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Akap10 A G 11: 61,873,020 L662P possibly damaging Het
Arhgef10 C T 8: 14,928,925 T64M possibly damaging Het
Ccr4 C T 9: 114,492,838 G53D probably damaging Het
Cdc25a T C 9: 109,884,108 probably benign Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Cmya5 A G 13: 93,074,475 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Ephb6 C T 6: 41,617,285 P583L probably damaging Het
Klra8 A T 6: 130,122,044 D185E possibly damaging Het
Meis2 T A 2: 115,864,480 Q394L probably benign Het
Olfr328 G A 11: 58,551,522 T239I probably damaging Het
Pzp C T 6: 128,490,089 G1107D probably damaging Het
Ralgapa2 C T 2: 146,346,811 W1350* probably null Het
Scand1 C A 2: 156,311,945 R135L probably damaging Het
Spopl A T 2: 23,511,443 M351K probably benign Het
Ube2e2 A G 14: 18,630,297 probably null Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Usp51 GATGCAT GAT X: 153,008,231 probably null Het
Wrap53 A T 11: 69,562,205 D425E probably damaging Het
Other mutations in Tmed4
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Tmed4 UTSW 11 6273750 missense probably benign 0.01
P4717OSA:Tmed4 UTSW 11 6273727 unclassified probably benign
R0005:Tmed4 UTSW 11 6271781 missense probably damaging 1.00
R1909:Tmed4 UTSW 11 6274694 missense probably damaging 1.00
R2926:Tmed4 UTSW 11 6271728 missense probably benign 0.01
R3081:Tmed4 UTSW 11 6274151 missense probably benign 0.09
R3801:Tmed4 UTSW 11 6274233 missense probably damaging 0.98
R4572:Tmed4 UTSW 11 6274461 frame shift probably null
R4748:Tmed4 UTSW 11 6271716 missense possibly damaging 0.67
R4858:Tmed4 UTSW 11 6274456 missense possibly damaging 0.64
R4997:Tmed4 UTSW 11 6274500 critical splice acceptor site probably null
R5788:Tmed4 UTSW 11 6271743 missense probably damaging 1.00
R6033:Tmed4 UTSW 11 6274491 nonsense probably null
R6033:Tmed4 UTSW 11 6274491 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAACCCTGCCACTGTAGACATAT -3'
(R):5'- CCAACTCCACCAGAATGGCTCTCTT -3'

Sequencing Primer
(F):5'- TGCCACTGTAGACATATACAGAAATC -3'
(R):5'- GTAAGAGGCTCATCAGCCTTAG -3'
Posted On2013-04-16