Incidental Mutation 'P4717OSA:Tmed4'
ID44001
Institutional Source Beutler Lab
Gene Symbol Tmed4
Ensembl Gene ENSMUSG00000004394
Gene Nametransmembrane p24 trafficking protein 4
Synonyms1110014L17Rik
Accession Numbers

Genbank: NM_134020; MGI: 1915070

Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #P4717OSA (G1) of strain 634
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location6270369-6274870 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 6273727 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004508] [ENSMUST00000132147]
Predicted Effect probably benign
Transcript: ENSMUST00000004508
SMART Domains Protein: ENSMUSP00000004508
Gene: ENSMUSG00000004394

DomainStartEndE-ValueType
EMP24_GP25L 29 222 3.21e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130621
Predicted Effect probably benign
Transcript: ENSMUST00000132147
SMART Domains Protein: ENSMUSP00000121643
Gene: ENSMUSG00000004394

DomainStartEndE-ValueType
EMP24_GP25L 29 170 3.3e-26 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 100% (27/27)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik A T 11: 3,938,178 probably null Het
Acsm5 A T 7: 119,531,972 E204D probably benign Het
Ahi1 G C 10: 20,972,110 R472S probably damaging Het
Bbof1 G A 12: 84,426,960 A355T probably damaging Het
Capn10 G T 1: 92,939,394 Q115H probably damaging Het
Clec4n A C 6: 123,244,540 Q114H probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Depdc1a T C 3: 159,522,547 V312A probably damaging Het
Gbp2 T C 3: 142,630,596 F236L possibly damaging Het
Glb1l2 A G 9: 26,766,021 I527T probably damaging Het
Hhla1 A G 15: 65,924,001 L452P probably damaging Het
Mcoln3 T G 3: 146,124,749 V78G probably damaging Het
Mylk T A 16: 34,977,113 probably benign Het
Nxpe2 T A 9: 48,326,377 M193L probably benign Het
Olig1 A T 16: 91,269,989 Y38F probably damaging Het
Pkhd1l1 T C 15: 44,523,499 V1256A probably benign Het
Pkhd1l1 A T 15: 44,528,247 I1570F probably damaging Het
Prss12 T C 3: 123,447,618 Y154H probably damaging Het
Rbp3 A G 14: 33,955,499 D468G probably damaging Het
Relt G A 7: 100,847,581 R360C probably damaging Het
Trhr C A 15: 44,197,435 T117K probably damaging Het
Ube2e2 A G 14: 18,630,297 probably null Het
Other mutations in Tmed4
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Tmed4 UTSW 11 6273750 missense probably benign 0.01
P4748:Tmed4 UTSW 11 6273727 unclassified probably benign
R0005:Tmed4 UTSW 11 6271781 missense probably damaging 1.00
R1909:Tmed4 UTSW 11 6274694 missense probably damaging 1.00
R2926:Tmed4 UTSW 11 6271728 missense probably benign 0.01
R3081:Tmed4 UTSW 11 6274151 missense probably benign 0.09
R3801:Tmed4 UTSW 11 6274233 missense probably damaging 0.98
R4572:Tmed4 UTSW 11 6274461 frame shift probably null
R4748:Tmed4 UTSW 11 6271716 missense possibly damaging 0.67
R4858:Tmed4 UTSW 11 6274456 missense possibly damaging 0.64
R4997:Tmed4 UTSW 11 6274500 critical splice acceptor site probably null
R5788:Tmed4 UTSW 11 6271743 missense probably damaging 1.00
R6033:Tmed4 UTSW 11 6274491 nonsense probably null
R6033:Tmed4 UTSW 11 6274491 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAACCCTGCCACTGTAGACATAT -3'
(R):5'- CCAACTCCACCAGAATGGCTCTCTT -3'

Sequencing Primer
(F):5'- TGCCACTGTAGACATATACAGAAATC -3'
(R):5'- GTAAGAGGCTCATCAGCCTTAG -3'
Posted On2013-05-31