Incidental Mutation 'R4106:Rpl10a'
ID 321403
Institutional Source Beutler Lab
Gene Symbol Rpl10a
Ensembl Gene ENSMUSG00000037805
Gene Name ribosomal protein L10A
Synonyms Nedd6, CsA-19
Accession Numbers
Essential gene? Probably essential (E-score: 0.933) question?
Stock # R4106 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 28547557-28550007 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28549933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 205 (Y205N)
Ref Sequence ENSEMBL: ENSMUSP00000048469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042334] [ENSMUST00000088007] [ENSMUST00000114799] [ENSMUST00000114801] [ENSMUST00000114803] [ENSMUST00000114804] [ENSMUST00000123248] [ENSMUST00000156505] [ENSMUST00000154873] [ENSMUST00000146104] [ENSMUST00000129935] [ENSMUST00000156862] [ENSMUST00000219703]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042334
AA Change: Y205N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000048469
Gene: ENSMUSG00000037805
AA Change: Y205N

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 12 213 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088007
SMART Domains Protein: ENSMUSP00000085322
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 212 5.9e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114799
SMART Domains Protein: ENSMUSP00000110447
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
TEA 52 123 9.04e-52 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 227 244 N/A INTRINSIC
PDB:3KYS|C 248 465 1e-120 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114801
SMART Domains Protein: ENSMUSP00000110449
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 7 98 1.8e-32 PFAM
Pfam:FA_FANCE 93 125 7.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114803
SMART Domains Protein: ENSMUSP00000110451
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 7 167 1.5e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114804
SMART Domains Protein: ENSMUSP00000110452
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 140 3.7e-56 PFAM
Pfam:FA_FANCE 137 170 6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123248
SMART Domains Protein: ENSMUSP00000119663
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 154 3.1e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146668
Predicted Effect probably benign
Transcript: ENSMUST00000156505
SMART Domains Protein: ENSMUSP00000118622
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 67 4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154873
SMART Domains Protein: ENSMUSP00000118582
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146104
SMART Domains Protein: ENSMUSP00000114386
Gene: ENSMUSG00000007570

DomainStartEndE-ValueType
Pfam:FA_FANCE 1 96 7.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129935
SMART Domains Protein: ENSMUSP00000114141
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 3 57 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156862
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219703
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L1P family of ribosomal proteins. It is located in the cytoplasm. The expression of this gene is downregulated in the thymus by cyclosporin-A (CsA), an immunosuppressive drug. Studies in mice have shown that the expression of the ribosomal protein L10a gene is downregulated in neural precursor cells during development. This gene previously was referred to as NEDD6 (neural precursor cell expressed, developmentally downregulated 6), but it has been renamed RPL10A (ribosomal protein 10a). As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 G T 5: 121,769,527 (GRCm39) S643Y probably damaging Het
Acox3 T C 5: 35,758,896 (GRCm39) F369S probably damaging Het
Cacna1a A G 8: 85,310,324 (GRCm39) I1461V possibly damaging Het
Cdc42bpb A C 12: 111,261,579 (GRCm39) V107G probably benign Het
Cdhr4 A G 9: 107,873,459 (GRCm39) D397G probably damaging Het
Chd1l T C 3: 97,505,019 (GRCm39) T183A probably benign Het
Cnbd2 T C 2: 156,177,318 (GRCm39) V92A probably damaging Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Cyp2j7 T C 4: 96,087,687 (GRCm39) T408A possibly damaging Het
H2-T24 A G 17: 36,328,370 (GRCm39) S38P possibly damaging Het
Mapkapk3 A G 9: 107,134,265 (GRCm39) V333A probably damaging Het
Muc5ac T G 7: 141,356,572 (GRCm39) V1053G possibly damaging Het
Myh1 T C 11: 67,102,403 (GRCm39) V898A probably benign Het
Nnt T C 13: 119,533,327 (GRCm39) I113V probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Or5d38 A T 2: 87,954,817 (GRCm39) C171S possibly damaging Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Scn3a A G 2: 65,325,379 (GRCm39) I1046T probably benign Het
Sertad4 AGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGA 1: 192,529,050 (GRCm39) probably benign Het
Sipa1l2 T C 8: 126,219,047 (GRCm39) K97E probably damaging Het
Slc19a3 A T 1: 83,000,678 (GRCm39) F113Y probably damaging Het
Slc22a6 A G 19: 8,595,874 (GRCm39) Q72R probably benign Het
St8sia2 A C 7: 73,610,509 (GRCm39) L258R probably damaging Het
Tas1r2 G A 4: 139,387,363 (GRCm39) R245H probably benign Het
Tcerg1l A G 7: 137,861,673 (GRCm39) V352A probably damaging Het
Tpo G A 12: 30,142,585 (GRCm39) P713L probably damaging Het
Tpp2 T C 1: 44,040,617 (GRCm39) Y293H possibly damaging Het
Ttn G C 2: 76,581,215 (GRCm39) A23226G probably damaging Het
Ttn C T 2: 76,608,809 (GRCm39) V15990I probably benign Het
Other mutations in Rpl10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Rpl10a APN 17 28,547,981 (GRCm39) missense probably damaging 1.00
IGL02955:Rpl10a APN 17 28,547,967 (GRCm39) missense probably damaging 0.99
R4921:Rpl10a UTSW 17 28,549,826 (GRCm39) missense probably benign 0.15
R5057:Rpl10a UTSW 17 28,549,607 (GRCm39) missense probably benign 0.00
R6352:Rpl10a UTSW 17 28,549,820 (GRCm39) missense possibly damaging 0.56
R6932:Rpl10a UTSW 17 28,548,424 (GRCm39) missense probably benign
R9374:Rpl10a UTSW 17 28,548,006 (GRCm39) missense possibly damaging 0.50
R9731:Rpl10a UTSW 17 28,547,594 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAAGAGCTAGGTCTGGGTGC -3'
(R):5'- ACCACCTGAGAAGCATTGTAGAC -3'

Sequencing Primer
(F):5'- TAAGCCTTTTCACTGGGGGAAAG -3'
(R):5'- TGAGAAGCATTGTAGACCCCTAC -3'
Posted On 2015-06-12