Mutagenetix > Incidental Mutation

Incidental Mutation 'R4462:Cdkn2d'

330186

Institutional Source

Beutler Lab

Gene Symbol

Cdkn2d

Ensembl Gene

ENSMUSG00000096472

Gene Name

cyclin dependent kinase inhibitor 2D

Synonyms

INK4d, p19, p19INK4d, INK4d

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R4462 (G1)

Quality Score

215

Status

Not validated

Chromosome

Chromosomal Location

21199759-21202553 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 21202185 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 21 (V21L)

Ref Sequence

ENSEMBL: ENSMUSP00000150701 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000038671] [ENSMUST00000086374] [ENSMUST00000115433] [ENSMUST00000215619] [ENSMUST00000213407] [ENSMUST00000213762] [ENSMUST00000184326]

AlphaFold

Q60773

Predicted Effect

probably benign
Transcript: ENSMUST00000003397

SMART Domains

Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309

Domain	Start	End	E-Value	Type
Pfam:Clat_adaptor_s	2	141	7.3e-9	PFAM
Pfam:Adap_comp_sub	157	422	7.3e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000038671

SMART Domains

Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
low complexity region	50	60	N/A	INTRINSIC
low complexity region	98	112	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
Pfam:Kri1	346	439	3.2e-27	PFAM
Pfam:Kri1_C	507	595	8.4e-37	PFAM
low complexity region	653	666	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000086374
AA Change: V21L

SMART Domains

Protein: ENSMUSP00000083561
Gene: ENSMUSG00000096472
AA Change: V21L

Domain	Start	End	E-Value	Type
ANK	41	69	1.01e2	SMART
ANK	73	102	1.73e-4	SMART
ANK	106	134	8.89e1	SMART
Blast:ANK	138	166	1e-9	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000115433

SMART Domains

Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309

Domain	Start	End	E-Value	Type
Pfam:Clat_adaptor_s	2	141	7.4e-9	PFAM
Pfam:Adap_comp_sub	157	424	4.7e-95	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183503

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184615

Predicted Effect

probably benign
Transcript: ENSMUST00000215619
AA Change: V21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000213407
AA Change: V21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000213762

Predicted Effect

probably benign
Transcript: ENSMUST00000184326

SMART Domains

Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047

Domain	Start	End	E-Value	Type
low complexity region	57	71	N/A	INTRINSIC
Pfam:Kri1	207	317	4.4e-27	PFAM
Pfam:Kri1_C	381	472	3.6e-36	PFAM
low complexity region	529	542	N/A	INTRINSIC

Meta Mutation Damage Score

0.0587

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to form a stable complex with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. The abundance of the transcript of this gene was found to oscillate in a cell-cycle dependent manner with the lowest expression at mid G1 and a maximal expression during S phase. The negative regulation of the cell cycle involved in this protein was shown to participate in repressing neuronal proliferation, as well as spermatogenesis. Two alternatively spliced variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both female and male homozygous null mice are fertile in spite of testicular atrophy and increased male germ cell apoptosis due to delayed meiosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcyap1r1	A	T	6: 55,457,084 (GRCm39)	I272F	possibly damaging	Het
Adgrl3	C	T	5: 81,836,357 (GRCm39)	A705V	probably damaging	Het
Arhgef12	A	T	9: 42,893,278 (GRCm39)	V975E	probably damaging	Het
Bahd1	C	T	2: 118,746,887 (GRCm39)	P169S	probably damaging	Het
Btnl6	A	G	17: 34,727,031 (GRCm39)	S500P	probably damaging	Het
Ccdc39	C	T	3: 33,868,817 (GRCm39)	R798Q	probably damaging	Het
Cdon	T	C	9: 35,368,876 (GRCm39)	V34A	probably damaging	Het
Defa17	A	G	8: 22,146,553 (GRCm39)	R60G	probably benign	Het
Egr2	GAA	GA	10: 67,375,733 (GRCm39)		probably null	Het
Fuca2	T	C	10: 13,378,979 (GRCm39)	V41A	probably damaging	Het
Ggt6	C	A	11: 72,328,654 (GRCm39)	H385N	possibly damaging	Het
Hgsnat	G	A	8: 26,444,664 (GRCm39)	T428I	probably damaging	Het
Nefh	A	G	11: 4,891,015 (GRCm39)	S535P	probably damaging	Het
Or2y6	T	A	11: 52,104,801 (GRCm39)	N5I	probably damaging	Het
Or8b1c	T	A	9: 38,384,360 (GRCm39)	F106I	probably benign	Het
Pkhd1l1	T	C	15: 44,445,200 (GRCm39)	F3691L	probably damaging	Het
Polr2a	T	C	11: 69,637,229 (GRCm39)	D282G	probably damaging	Het
Ranbp17	T	C	11: 33,167,421 (GRCm39)		probably null	Het
Slc13a2	T	C	11: 78,295,213 (GRCm39)	T187A	probably benign	Het
Slco3a1	A	C	7: 74,204,311 (GRCm39)	S10A	probably benign	Het
Snph	A	T	2: 151,436,035 (GRCm39)	S229T	probably damaging	Het
Trim38	A	G	13: 23,975,435 (GRCm39)	Y458C	probably null	Het
Ubr4	A	G	4: 139,145,813 (GRCm39)	M1537V	possibly damaging	Het

Other mutations in Cdkn2d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02516:Cdkn2d	APN	9	21,200,439 (GRCm39)	missense	probably benign	0.04
R0238:Cdkn2d	UTSW	9	21,202,288 (GRCm39)	start gained	probably benign
R0238:Cdkn2d	UTSW	9	21,202,288 (GRCm39)	start gained	probably benign
R2064:Cdkn2d	UTSW	9	21,202,175 (GRCm39)	missense	probably damaging	1.00
R4454:Cdkn2d	UTSW	9	21,202,185 (GRCm39)	missense	probably benign
R4455:Cdkn2d	UTSW	9	21,202,185 (GRCm39)	missense	probably benign
R4456:Cdkn2d	UTSW	9	21,202,185 (GRCm39)	missense	probably benign
R4457:Cdkn2d	UTSW	9	21,202,185 (GRCm39)	missense	probably benign
R4458:Cdkn2d	UTSW	9	21,202,185 (GRCm39)	missense	probably benign
R4463:Cdkn2d	UTSW	9	21,202,185 (GRCm39)	missense	probably benign
R4735:Cdkn2d	UTSW	9	21,202,185 (GRCm39)	missense	probably benign
R4854:Cdkn2d	UTSW	9	21,202,223 (GRCm39)	missense	probably benign
R5493:Cdkn2d	UTSW	9	21,200,303 (GRCm39)	missense	probably benign	0.00
R7560:Cdkn2d	UTSW	9	21,200,540 (GRCm39)	missense	probably damaging	1.00
R8117:Cdkn2d	UTSW	9	21,200,447 (GRCm39)	missense	probably benign	0.01
R9603:Cdkn2d	UTSW	9	21,202,139 (GRCm39)	missense	possibly damaging	0.91
R9762:Cdkn2d	UTSW	9	21,200,383 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTAGACAAGAGCTGAAAAGCCATC -3'
(R):5'- ATCATAGAGTTGGCCCTGGTG -3'

Sequencing Primer
(F):5'- GAGCTGAAAAGCCATCCCCTC -3'
(R):5'- TGGCACCGCAGTCCCTAG -3'

Posted On

2015-07-21