Incidental Mutation 'R4496:Gpt'
ID330992
Institutional Source Beutler Lab
Gene Symbol Gpt
Ensembl Gene ENSMUSG00000022546
Gene Nameglutamic pyruvic transaminase, soluble
Synonyms1300007J06Rik, Gpt1, Gpt-1, 2310022B03Rik, ALT
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76695716-76699686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76698463 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 276 (Q276L)
Ref Sequence ENSEMBL: ENSMUSP00000155553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000023203] [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229140] [ENSMUST00000229734] [ENSMUST00000229679] [ENSMUST00000231028]
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000023203
AA Change: Q276L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546
AA Change: Q276L

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037551
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134449
Predicted Effect probably benign
Transcript: ENSMUST00000135388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140730
Predicted Effect probably benign
Transcript: ENSMUST00000150399
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229098
Predicted Effect probably damaging
Transcript: ENSMUST00000229140
AA Change: Q36L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably damaging
Transcript: ENSMUST00000229734
AA Change: Q255L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000229679
AA Change: Q276L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Meta Mutation Damage Score 0.7403 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes cytosolic alanine aminotransaminase 1 (ALT1); also known as glutamate-pyruvate transaminase 1. This enzyme catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate and, therefore, plays a key role in the intermediary metabolism of glucose and amino acids. Serum activity levels of this enzyme are routinely used as a biomarker of liver injury caused by drug toxicity, infection, alcohol, and steatosis. A related gene on chromosome 16 encodes a putative mitochondrial alanine aminotransaminase.[provided by RefSeq, Nov 2009]
PHENOTYPE: Electrophoretic variants are detected in C57BL/6, BALB/c and DBA/2 (a allele); in MA/J and NZB/Bl (b allele). M. m. molossinus and M. m. castaneus have either the b or c allele. In liver, GPT1 activity rises dramatically at 12-19 days to adult levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Ikzf5 T C 7: 131,396,664 probably null Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Gpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Gpt APN 15 76698782 missense probably damaging 1.00
IGL02061:Gpt APN 15 76699417 unclassified probably benign
IGL03027:Gpt APN 15 76698089 unclassified probably benign
R2091:Gpt UTSW 15 76697976 missense possibly damaging 0.87
R2903:Gpt UTSW 15 76698466 missense probably damaging 1.00
R3835:Gpt UTSW 15 76698583 missense probably damaging 1.00
R4855:Gpt UTSW 15 76699285 missense probably damaging 0.99
R4932:Gpt UTSW 15 76698840 missense probably benign 0.05
R5970:Gpt UTSW 15 76699352 splice site probably null
R6165:Gpt UTSW 15 76697970 missense probably benign 0.28
R6914:Gpt UTSW 15 76697592 missense probably benign
R7204:Gpt UTSW 15 76698999 missense probably benign 0.00
R7397:Gpt UTSW 15 76698517 missense probably benign 0.05
R7654:Gpt UTSW 15 76698330 missense probably benign 0.37
R7808:Gpt UTSW 15 76698893 splice site probably null
R8057:Gpt UTSW 15 76696772 intron probably benign
R8389:Gpt UTSW 15 76699042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCATCTTCACACTCCAGGG -3'
(R):5'- AGCATGAGTTGAGGCTGGTC -3'

Sequencing Primer
(F):5'- TTCACACTCCAGGGCAGGTG -3'
(R):5'- AGTGACTGAGAGTCCTCTAGC -3'
Posted On2015-07-21