Incidental Mutation 'R6403:Mb21d2'
ID516234
Institutional Source Beutler Lab
Gene Symbol Mb21d2
Ensembl Gene ENSMUSG00000051065
Gene NameMab-21 domain containing 2
Synonyms
MMRRC Submission 044382-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6403 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location28826176-28929673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28828517 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 235 (I235T)
Ref Sequence ENSEMBL: ENSMUSP00000097600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100023]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100023
AA Change: I235T

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097600
Gene: ENSMUSG00000051065
AA Change: I235T

DomainStartEndE-ValueType
Mab-21 120 405 8.7e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232571
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Aox1 A G 1: 58,068,435 I623V probably damaging Het
Camsap2 G A 1: 136,280,800 R317* probably null Het
Carmil1 G A 13: 24,081,967 R271C probably damaging Het
Ces2b T A 8: 104,836,269 L323* probably null Het
Copb1 T A 7: 114,238,451 I286F probably damaging Het
Dnajb11 T A 16: 22,870,941 V285D probably damaging Het
Dok5 G T 2: 170,829,900 A79S probably damaging Het
Enpp2 T C 15: 54,863,764 N557S probably damaging Het
Gm13088 G A 4: 143,655,773 Q118* probably null Het
Hexa G A 9: 59,557,361 R178H probably damaging Het
Iars T C 13: 49,687,495 S35P probably damaging Het
Il3ra G T 14: 14,347,137 A3S probably damaging Het
Iqcm T C 8: 75,577,996 probably null Het
Krt9 G T 11: 100,189,659 S420R probably damaging Het
Lca5l T C 16: 96,173,845 N293S probably benign Het
Ncbp3 A G 11: 73,078,976 T550A probably benign Het
Nckipsd G T 9: 108,811,683 R139L possibly damaging Het
Nxn A G 11: 76,399,020 V14A probably benign Het
Olfr926 T C 9: 38,877,242 L22P probably damaging Het
Rprd2 C A 3: 95,766,087 C668F possibly damaging Het
Tmem87a A T 2: 120,380,771 M231K possibly damaging Het
Trappc8 A G 18: 20,866,071 V333A probably benign Het
Trit1 C A 4: 123,039,579 T103K possibly damaging Het
Tspan13 A G 12: 36,015,705 F203S probably damaging Het
Vmn2r114 C T 17: 23,309,965 D388N probably damaging Het
Zfp617 C T 8: 71,929,171 A55V probably benign Het
Other mutations in Mb21d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Mb21d2 APN 16 28827743 utr 3 prime probably benign
IGL02153:Mb21d2 APN 16 28929488 missense probably benign 0.31
IGL02678:Mb21d2 APN 16 28828049 missense probably benign 0.00
R0570:Mb21d2 UTSW 16 28929572 missense probably benign 0.01
R0571:Mb21d2 UTSW 16 28929572 missense probably benign 0.01
R0630:Mb21d2 UTSW 16 28929572 missense probably benign 0.01
R1728:Mb21d2 UTSW 16 28828421 missense probably benign 0.00
R1729:Mb21d2 UTSW 16 28828421 missense probably benign 0.00
R1866:Mb21d2 UTSW 16 28828515 missense possibly damaging 0.67
R3801:Mb21d2 UTSW 16 28828003 missense possibly damaging 0.95
R7384:Mb21d2 UTSW 16 28828912 missense probably benign
R7464:Mb21d2 UTSW 16 28929546 missense possibly damaging 0.85
R8030:Mb21d2 UTSW 16 28827803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACTGCCTGAAATGCACTTC -3'
(R):5'- ACGGTGCCACCAACTACTTC -3'

Sequencing Primer
(F):5'- GACTGCCTGAAATGCACTTCTTCAG -3'
(R):5'- CTTCTCCCCCACCAAAGTG -3'
Posted On2018-05-04