Incidental Mutation 'R6403:Trappc8'
ID516237
Institutional Source Beutler Lab
Gene Symbol Trappc8
Ensembl Gene ENSMUSG00000033382
Gene Nametrafficking protein particle complex 8
SynonymsD030074E01Rik, Trs85, 5033403J15Rik
MMRRC Submission 044382-MU
Accession Numbers

Genbank: NM_029491; MGI: 2443008

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6403 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20817223-20896093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20866071 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 333 (V333A)
Ref Sequence ENSEMBL: ENSMUSP00000153183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025177] [ENSMUST00000097658] [ENSMUST00000224530] [ENSMUST00000225661]
Predicted Effect probably benign
Transcript: ENSMUST00000025177
AA Change: V334A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025177
Gene: ENSMUSG00000033382
AA Change: V334A

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 157 604 1e-167 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097658
AA Change: V334A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095262
Gene: ENSMUSG00000033382
AA Change: V334A

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 152 605 9.3e-135 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224530
Predicted Effect probably benign
Transcript: ENSMUST00000225661
AA Change: V333A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars A G 8: 111,042,249 D227G possibly damaging Het
Aox1 A G 1: 58,068,435 I623V probably damaging Het
Camsap2 G A 1: 136,280,800 R317* probably null Het
Carmil1 G A 13: 24,081,967 R271C probably damaging Het
Ces2b T A 8: 104,836,269 L323* probably null Het
Copb1 T A 7: 114,238,451 I286F probably damaging Het
Dnajb11 T A 16: 22,870,941 V285D probably damaging Het
Dok5 G T 2: 170,829,900 A79S probably damaging Het
Enpp2 T C 15: 54,863,764 N557S probably damaging Het
Gm13088 G A 4: 143,655,773 Q118* probably null Het
Hexa G A 9: 59,557,361 R178H probably damaging Het
Iars T C 13: 49,687,495 S35P probably damaging Het
Il3ra G T 14: 14,347,137 A3S probably damaging Het
Iqcm T C 8: 75,577,996 probably null Het
Krt9 G T 11: 100,189,659 S420R probably damaging Het
Lca5l T C 16: 96,173,845 N293S probably benign Het
Mb21d2 A G 16: 28,828,517 I235T possibly damaging Het
Ncbp3 A G 11: 73,078,976 T550A probably benign Het
Nckipsd G T 9: 108,811,683 R139L possibly damaging Het
Nxn A G 11: 76,399,020 V14A probably benign Het
Olfr926 T C 9: 38,877,242 L22P probably damaging Het
Rprd2 C A 3: 95,766,087 C668F possibly damaging Het
Tmem87a A T 2: 120,380,771 M231K possibly damaging Het
Trit1 C A 4: 123,039,579 T103K possibly damaging Het
Tspan13 A G 12: 36,015,705 F203S probably damaging Het
Vmn2r114 C T 17: 23,309,965 D388N probably damaging Het
Zfp617 C T 8: 71,929,171 A55V probably benign Het
Other mutations in Trappc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Trappc8 APN 18 20836978 missense probably benign 0.20
IGL01367:Trappc8 APN 18 20866119 missense probably benign 0.01
IGL01537:Trappc8 APN 18 20835004 missense probably benign
IGL01563:Trappc8 APN 18 20837046 missense probably benign 0.00
IGL01982:Trappc8 APN 18 20874712 splice site probably benign
IGL02709:Trappc8 APN 18 20837178 missense possibly damaging 0.94
IGL03126:Trappc8 APN 18 20863595 missense probably damaging 1.00
IGL03290:Trappc8 APN 18 20820935 missense probably damaging 1.00
IGL03348:Trappc8 APN 18 20852781 missense probably damaging 1.00
hoppa UTSW 18 20836900 missense probably benign 0.05
Lagomorpha UTSW 18 20818190 missense probably benign 0.11
rabbit UTSW 18 20874680 missense probably damaging 1.00
E7848:Trappc8 UTSW 18 20850918 missense probably damaging 0.99
R0483:Trappc8 UTSW 18 20845601 missense possibly damaging 0.60
R0492:Trappc8 UTSW 18 20866186 missense probably benign 0.07
R0506:Trappc8 UTSW 18 20844188 missense possibly damaging 0.49
R0610:Trappc8 UTSW 18 20837188 missense probably damaging 1.00
R0892:Trappc8 UTSW 18 20831608 critical splice donor site probably null
R1561:Trappc8 UTSW 18 20841623 nonsense probably null
R1589:Trappc8 UTSW 18 20863551 missense probably damaging 1.00
R1700:Trappc8 UTSW 18 20832998 missense probably damaging 1.00
R1785:Trappc8 UTSW 18 20834940 splice site probably null
R1786:Trappc8 UTSW 18 20834940 splice site probably null
R1989:Trappc8 UTSW 18 20845651 missense probably benign 0.04
R2181:Trappc8 UTSW 18 20819222 critical splice donor site probably null
R2294:Trappc8 UTSW 18 20866154 nonsense probably null
R4551:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R4594:Trappc8 UTSW 18 20836948 missense probably benign
R4631:Trappc8 UTSW 18 20867808 missense probably benign 0.22
R4734:Trappc8 UTSW 18 20841572 nonsense probably null
R4834:Trappc8 UTSW 18 20825065 missense probably damaging 0.99
R5114:Trappc8 UTSW 18 20844180 missense probably benign 0.04
R5262:Trappc8 UTSW 18 20818190 missense probably benign 0.11
R5384:Trappc8 UTSW 18 20833062 intron probably null
R5476:Trappc8 UTSW 18 20865108 missense probably damaging 1.00
R5503:Trappc8 UTSW 18 20836900 missense probably benign 0.05
R5577:Trappc8 UTSW 18 20836779 nonsense probably null
R5809:Trappc8 UTSW 18 20818082 missense probably benign 0.08
R5825:Trappc8 UTSW 18 20873920 missense probably damaging 1.00
R5886:Trappc8 UTSW 18 20874680 missense probably damaging 1.00
R5936:Trappc8 UTSW 18 20874688 missense probably damaging 1.00
R6024:Trappc8 UTSW 18 20833009 missense probably damaging 0.98
R6105:Trappc8 UTSW 18 20846447 critical splice donor site probably null
R6229:Trappc8 UTSW 18 20870745 missense probably benign 0.00
R6376:Trappc8 UTSW 18 20837075 missense probably benign 0.07
R6459:Trappc8 UTSW 18 20836868 missense probably benign 0.40
R6673:Trappc8 UTSW 18 20885257 missense probably benign 0.01
R7041:Trappc8 UTSW 18 20874672 missense probably benign 0.10
R7276:Trappc8 UTSW 18 20818091 missense probably damaging 0.99
R7341:Trappc8 UTSW 18 20852647 missense probably damaging 1.00
R7684:Trappc8 UTSW 18 20863502 missense probably benign 0.01
R7702:Trappc8 UTSW 18 20825062 missense probably damaging 0.99
X0065:Trappc8 UTSW 18 20860522 missense probably benign 0.03
Z1177:Trappc8 UTSW 18 20831663 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGCTCAGGAGAACTTCATCAC -3'
(R):5'- CTGTTGCATTCTGAAAGTAAAGGAG -3'

Sequencing Primer
(F):5'- CGTCTTACCTGATCATTTAACTG -3'
(R):5'- AGAGATTTGTTTTTCAGTAGATGGCC -3'
Posted On2018-05-04