Incidental Mutation 'R8339:Xxylt1'
ID644817
Institutional Source Beutler Lab
Gene Symbol Xxylt1
Ensembl Gene ENSMUSG00000047434
Gene Namexyloside xylosyltransferase 1
SynonymsAI480653
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8339 (G1)
Quality Score131.008
Status Not validated
Chromosome16
Chromosomal Location30955144-31081432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31081040 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 99 (H99R)
Ref Sequence ENSEMBL: ENSMUSP00000050246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055389
AA Change: H99R

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050246
Gene: ENSMUSG00000047434
AA Change: H99R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 58 87 N/A INTRINSIC
Pfam:Glyco_transf_8 103 369 6.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,285,672 F1549S probably damaging Het
Ablim1 T C 19: 57,043,849 E710G probably benign Het
Adam34 A T 8: 43,650,603 H668Q probably benign Het
Asphd2 A T 5: 112,391,635 Y111N possibly damaging Het
Camsap1 A G 2: 25,982,805 I45T possibly damaging Het
Ccdc88c A T 12: 100,941,140 L984* probably null Het
Ccr1 T G 9: 123,963,726 N256H probably damaging Het
Cep295 A T 9: 15,325,550 D254E Het
Cmya5 G T 13: 93,091,634 Y2315* probably null Het
Cspp1 G T 1: 10,113,667 R839I probably damaging Het
Dbn1 A T 13: 55,482,169 D153E probably benign Het
Dnah7a G T 1: 53,685,019 L96I probably benign Het
G6pc A G 11: 101,376,488 T255A possibly damaging Het
Gm4788 T A 1: 139,732,419 E656V probably damaging Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Il12a T A 3: 68,692,105 C33* probably null Het
Iqce T C 5: 140,674,338 E555G probably damaging Het
Itpr2 T C 6: 146,312,898 M1484V probably benign Het
Klc2 A G 19: 5,109,534 S518P probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1015 C A 2: 85,785,532 T7N probably damaging Het
Olfr1535 A T 13: 21,555,826 N65K probably damaging Het
Olfr911-ps1 T C 9: 38,524,421 S230P probably damaging Het
Otogl T A 10: 107,789,535 I1516F probably damaging Het
Otogl G T 10: 107,789,536 S1515R probably benign Het
Pacs1 A T 19: 5,142,623 V627E probably damaging Het
Ptprb A C 10: 116,283,451 R163S probably benign Het
Ralgps2 G T 1: 156,821,438 P432Q probably null Het
Rgl3 T C 9: 21,987,529 T205A probably benign Het
Rock2 G T 12: 16,974,860 W1213L probably damaging Het
Satb1 T A 17: 51,782,949 H290L probably damaging Het
Scn1a T C 2: 66,286,029 Y422C probably damaging Het
Sgcg T A 14: 61,232,517 M132L probably benign Het
Shank1 A G 7: 44,326,165 S478G unknown Het
Slc18a1 A T 8: 69,065,621 M247K possibly damaging Het
Slc37a4 A G 9: 44,402,427 I417V probably benign Het
Slc9b2 A G 3: 135,324,602 M227V possibly damaging Het
Tcf20 C A 15: 82,852,676 V1525L probably benign Het
Tril G A 6: 53,817,933 T768I possibly damaging Het
Zfp653 T C 9: 22,057,917 E351G probably damaging Het
Other mutations in Xxylt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0387:Xxylt1 UTSW 16 30957376 missense probably benign 0.28
R0412:Xxylt1 UTSW 16 31007798 missense probably damaging 1.00
R1140:Xxylt1 UTSW 16 31007848 critical splice acceptor site probably null
R1871:Xxylt1 UTSW 16 30957417 missense probably damaging 1.00
R2006:Xxylt1 UTSW 16 31050768 missense probably damaging 1.00
R5808:Xxylt1 UTSW 16 31050685 missense probably damaging 1.00
R6089:Xxylt1 UTSW 16 31080981 missense probably damaging 0.98
R6208:Xxylt1 UTSW 16 31007808 missense probably benign 0.01
R8017:Xxylt1 UTSW 16 31007819 missense probably damaging 1.00
R8738:Xxylt1 UTSW 16 31081146 missense probably benign 0.36
RF007:Xxylt1 UTSW 16 31050680 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTCACCTTGCACTTGAAGC -3'
(R):5'- CTTTTAGGTATCCACGCTCGTG -3'

Sequencing Primer
(F):5'- TTGCACTTGAAGCCGGCG -3'
(R):5'- ACGCTCGTGATTGGCTC -3'
Posted On2020-09-02