Incidental Mutation 'R0623:Kpna6'
ID68116
Institutional Source Beutler Lab
Gene Symbol Kpna6
Ensembl Gene ENSMUSG00000003731
Gene Namekaryopherin (importin) alpha 6
SynonymsIPOA7, NPI-2
MMRRC Submission 038812-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0623 (G1)
Quality Score95
Status Not validated
Chromosome4
Chromosomal Location129643980-129672767 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 129655416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003828] [ENSMUST00000102590] [ENSMUST00000126010]
Predicted Effect probably benign
Transcript: ENSMUST00000003828
SMART Domains Protein: ENSMUSP00000003828
Gene: ENSMUSG00000003731

DomainStartEndE-ValueType
Pfam:IBB 2 100 9.5e-28 PFAM
ARM 109 151 2.46e-4 SMART
ARM 153 193 6.73e-11 SMART
ARM 195 236 3.19e-3 SMART
ARM 239 278 6.64e-1 SMART
ARM 280 320 1.16e-5 SMART
ARM 322 362 1.98e-8 SMART
ARM 364 404 6.68e-6 SMART
ARM 407 447 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102590
SMART Domains Protein: ENSMUSP00000099650
Gene: ENSMUSG00000003731

DomainStartEndE-ValueType
Pfam:IBB 9 102 4.4e-27 PFAM
ARM 112 154 2.46e-4 SMART
ARM 156 196 6.73e-11 SMART
ARM 198 239 3.19e-3 SMART
ARM 242 281 6.64e-1 SMART
ARM 283 323 1.16e-5 SMART
ARM 325 365 1.98e-8 SMART
ARM 367 407 6.68e-6 SMART
ARM 410 450 1.89e-5 SMART
Pfam:Arm_3 464 514 5.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126010
SMART Domains Protein: ENSMUSP00000114265
Gene: ENSMUSG00000003731

DomainStartEndE-ValueType
Pfam:IBB 2 88 3.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146215
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.2%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. The protein encoded by this gene is a member of the importin alpha family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null mutation are infertile and show a block in zygotic genome activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 2 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Crlf2 G C 5: 109,557,138 P67R probably damaging Het
Jmy G A 13: 93,452,817 T644I probably benign Het
Other mutations in Kpna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Kpna6 APN 4 129655483 missense probably damaging 1.00
IGL02750:Kpna6 APN 4 129661377 missense probably damaging 1.00
IGL02904:Kpna6 APN 4 129650687 missense probably benign 0.24
IGL02998:Kpna6 APN 4 129655504 missense probably benign 0.00
IGL03370:Kpna6 APN 4 129655521 missense probably damaging 1.00
krazy_eight UTSW 4 129655428 critical splice donor site probably null
magnificent_seven UTSW 4 129649306 nonsense probably null
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0305:Kpna6 UTSW 4 129649249 missense probably benign 0.00
R0390:Kpna6 UTSW 4 129657804 missense possibly damaging 0.61
R0646:Kpna6 UTSW 4 129650790 missense probably benign 0.43
R1067:Kpna6 UTSW 4 129648103 missense probably benign 0.39
R1348:Kpna6 UTSW 4 129661359 nonsense probably null
R1661:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1665:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1766:Kpna6 UTSW 4 129657442 missense probably benign 0.33
R4833:Kpna6 UTSW 4 129657779 missense possibly damaging 0.51
R4941:Kpna6 UTSW 4 129648032 missense probably damaging 1.00
R4974:Kpna6 UTSW 4 129656405 splice site probably null
R5244:Kpna6 UTSW 4 129655428 critical splice donor site probably null
R5914:Kpna6 UTSW 4 129672692 unclassified probably benign
R6148:Kpna6 UTSW 4 129649306 nonsense probably null
R6713:Kpna6 UTSW 4 129653984 missense probably damaging 1.00
R6799:Kpna6 UTSW 4 129657454 missense probably damaging 0.99
R6942:Kpna6 UTSW 4 129651721 splice site probably null
R7073:Kpna6 UTSW 4 129654346 missense probably damaging 1.00
R7794:Kpna6 UTSW 4 129648051 missense probably benign
R7815:Kpna6 UTSW 4 129657797 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTAGGAGGACTCTTGCTGAGCAC -3'
(R):5'- AGTCCCCTCTCTGCTAAAGGATGG -3'

Sequencing Primer
(F):5'- GAAAAAGTCTTGACTCTCTACCTTGG -3'
(R):5'- TGCAGACCTCTCAGTTGTG -3'
Posted On2013-09-03