Incidental Mutation 'R9063:1110004F10Rik'
ID 689087
Institutional Source Beutler Lab
Gene Symbol 1110004F10Rik
Ensembl Gene ENSMUSG00000030663
Gene Name RIKEN cDNA 1110004F10 gene
Synonyms sid2057
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R9063 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 116039397-116105210 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 116104425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 178 (S178A)
Ref Sequence ENSEMBL: ENSMUSP00000032899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032899] [ENSMUST00000106607] [ENSMUST00000106608] [ENSMUST00000151254] [ENSMUST00000205427] [ENSMUST00000205450]
AlphaFold Q9R0P4
Predicted Effect probably benign
Transcript: ENSMUST00000032899
AA Change: S178A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032899
Gene: ENSMUSG00000030663
AA Change: S178A

DomainStartEndE-ValueType
Pfam:SMAP 27 103 1.1e-17 PFAM
low complexity region 105 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106607
AA Change: S91A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102218
Gene: ENSMUSG00000030663
AA Change: S91A

DomainStartEndE-ValueType
low complexity region 18 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106608
AA Change: S134A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102219
Gene: ENSMUSG00000030663
AA Change: S134A

DomainStartEndE-ValueType
Pfam:SMAP 1 59 7.8e-10 PFAM
low complexity region 61 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151254
SMART Domains Protein: ENSMUSP00000116035
Gene: ENSMUSG00000030663

DomainStartEndE-ValueType
Pfam:SMAP 26 79 4.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205427
Predicted Effect probably benign
Transcript: ENSMUST00000205450
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T C 19: 53,233,871 L303P probably damaging Het
Agr2 T A 12: 36,003,899 *176K probably null Het
Apobr C T 7: 126,586,748 T477I probably benign Het
Cdca7l G A 12: 117,874,801 V336M probably damaging Het
Cep63 T G 9: 102,619,028 H18P unknown Het
Copa A G 1: 172,116,962 D838G probably benign Het
Cspg4 G T 9: 56,888,403 V1141L probably benign Het
D930020B18Rik A G 10: 121,661,097 T146A probably benign Het
Dapk1 A T 13: 60,718,450 I206L probably benign Het
Emsy C T 7: 98,646,477 D73N probably damaging Het
Esr2 A T 12: 76,121,816 Y540N probably benign Het
Exoc7 C A 11: 116,289,275 V668L probably benign Het
Fcgbp C T 7: 28,091,852 T846I probably damaging Het
Fhod3 A G 18: 25,020,715 E418G probably damaging Het
Fryl G A 5: 73,081,003 R1467C possibly damaging Het
Gas2l3 A G 10: 89,413,696 I520T probably benign Het
Gfod1 A G 13: 43,200,804 C232R probably benign Het
Gpr61 T C 3: 108,150,239 R369G probably benign Het
Hk1 T C 10: 62,286,650 Y423C probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Jmy T C 13: 93,499,072 R79G probably benign Het
Kcnn4 T A 7: 24,377,509 V161E probably damaging Het
Kif15 T A 9: 123,004,641 I1040N probably damaging Het
Kif2b A G 11: 91,575,828 L543S probably damaging Het
Kpna2 A G 11: 106,992,663 I81T probably benign Het
Krt12 A G 11: 99,416,931 S444P probably benign Het
Lmnb2 C T 10: 80,906,171 V29M probably benign Het
Lmod2 T C 6: 24,603,365 V113A probably benign Het
Lrp1b T C 2: 41,341,826 T1211A Het
Lrrc8d T C 5: 105,814,093 S790P probably damaging Het
Map3k4 A G 17: 12,263,991 V613A probably damaging Het
Marveld2 T C 13: 100,612,145 N142S probably benign Het
Mfsd7a A G 5: 108,442,237 L433P probably damaging Het
Mgll G A 6: 88,825,708 V282I possibly damaging Het
Mief2 G A 11: 60,731,488 E295K probably damaging Het
Mmrn2 A T 14: 34,398,610 H479L probably benign Het
Myh15 T A 16: 49,092,755 N358K probably benign Het
Mzf1 T G 7: 13,053,078 K101Q probably damaging Het
Ncbp3 T A 11: 73,073,427 L401Q probably damaging Het
Nck2 T C 1: 43,554,343 C237R possibly damaging Het
Nlrp9a T G 7: 26,573,866 N976K possibly damaging Het
Nol11 A G 11: 107,173,414 V524A probably benign Het
Nol11 T C 11: 107,179,031 Y331C possibly damaging Het
Nsmf A T 2: 25,062,610 H149L probably benign Het
Olfm3 T C 3: 115,120,933 V231A probably benign Het
Olfr364-ps1 A T 2: 37,146,634 M141L probably benign Het
Olfr544 T C 7: 102,484,724 Y132C probably damaging Het
Olfr575 A G 7: 102,955,239 S121P probably benign Het
Pcdhgb5 T A 18: 37,731,686 F178Y probably damaging Het
Plk2 T A 13: 110,396,386 S160R possibly damaging Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Ppp1cc A G 5: 122,168,216 N33D probably benign Het
Ptpn23 T C 9: 110,389,625 E499G possibly damaging Het
Pwp1 A G 10: 85,884,567 H356R probably benign Het
Rbsn G T 6: 92,194,019 T307K probably benign Het
Rnf19a G A 15: 36,265,469 Q161* probably null Het
Scin T C 12: 40,084,337 D236G possibly damaging Het
Setd1a G A 7: 127,786,386 R755H possibly damaging Het
Sik3 C T 9: 46,212,437 T1178I probably benign Het
Tex26 C T 5: 149,470,361 R272C probably damaging Het
Trim60 T A 8: 65,000,813 K261N possibly damaging Het
Tspan9 A G 6: 127,967,109 I76T probably damaging Het
Ttn T A 2: 76,758,489 Y21412F probably damaging Het
Ttn A T 2: 76,880,563 I8409N unknown Het
Unc80 T C 1: 66,606,657 probably null Het
Ush2a A T 1: 188,263,260 Q76L probably benign Het
Usp1 G A 4: 98,931,152 V284I probably benign Het
Usp31 A G 7: 121,707,243 V4A probably benign Het
Vmn2r88 G A 14: 51,410,872 probably benign Het
Zfp959 G A 17: 55,897,221 R86K probably benign Het
Other mutations in 1110004F10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2391:1110004F10Rik UTSW 7 116104226 missense probably damaging 0.99
R4789:1110004F10Rik UTSW 7 116093522 missense probably benign 0.03
R6249:1110004F10Rik UTSW 7 116103270 missense probably damaging 1.00
R6802:1110004F10Rik UTSW 7 116099490 missense probably damaging 1.00
R7960:1110004F10Rik UTSW 7 116103246 missense possibly damaging 0.83
R8509:1110004F10Rik UTSW 7 116104434 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCTCATAGGCCTTTGGTTGATG -3'
(R):5'- GTAACCCATGGCATTTGAAAGC -3'

Sequencing Primer
(F):5'- GTTTTAGGTAGAAGATCATGATGGAG -3'
(R):5'- TGGCATTTGAAAGCAAACACTC -3'
Posted On 2021-11-19