Phenotypic Mutation 'heedless'

• Allele: heedless
• Mutation Type: missense
• Chromosome: 18
• Coordinate: 36,725,551 bp (GRCm38)
• Base Change: G ⇒ A (forward strand)
• Gene: Cd14
• Gene Name: CD14 antigen
• Synonym(s): monocyte differentiation antigen CD14; myeloid cell-specific leucine-rich glycoprotein
• Chromosomal Location: 36,725,074-36,726,736 bp (-)
• MGI Phenotype: FUNCTION: This gene encodes a protein that plays an important role in the innate immune response and is expressed in monocyte/macrophage cells. This gene product acts as a co-receptor that binds several microbial and fungal molecules, including lipopolysaccharides (LPS). This proteins LPS-binding activity is enhanced by the LPS binding protein (LBP) to allow binding to the TLR4-MD-2 co-receptor complex. The product of this gene is found in two forms, either as a soluble protein or attached to the cell surface by a glycosylphosphatidylinositol anchor. [provided by RefSeq, Jul 2014] ; PHENOTYPE: Homozygous null mice exhibit macrophages with impaired responses to LPS or E.coli, resulting in a reduction or loss of cytokine production. Macrophages also cannot contain vesicular stomatitis virus infection. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Glutamine changed to Leucine
• Institutional Source: Beutler Lab
• Gene Model: not available
• AlphaFold: P10810
• PDB Structure: Crystal structure of CD14 [X-RAY DIFFRACTION]
• SMART Domains: Protein: ENSMUSP00000056669; Gene: ENSMUSG00000051439; AA Change: Q77L

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:1WWL|B	18	329	N/A	PDB
SCOP:d1fqva2	86	326	1e-9	SMART

• Predicted Effect: probably benign ; PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
  (Using ENSMUST00000061829)
• Meta Mutation Damage Score: Not available
• Is this an essential gene?: Probably nonessential (E-score: 0.097)
• Phenotypic Category: Autosomal Recessive
• Penetrance: 100%
• Mode of Inheritance: Autosomal Recessive
• Local Stock: Live Mice, Embryos, gDNA
• MMRRC Submission: 010472-UCD
• Last Updated: 2017-03-27 4:34 PM by Katherine Timer
• Record Created: unknown
• Record Posted: 2007-11-15
• Science Writers: Alyson Mack, Eva Marie Y. Moresco
• Illustrators: Diantha La Vine
• Authors: Zhengfan Jiang, Bruce Beutler

Accession Number

NCBI RefSeq: NM_009841; MGI: 88318

Alleles Listed at MGI

All alleles(3) : Targeted, knock-out(2) Chemically induced(1)

Phenotypic Description

Figure 1. Rough LPS and TLR2-6 specificity of the heedless mutation. (a-l) Macrophages from wild-type (WT), heterozygous heedless (Hdl het), homozygous heedless (Hdl homo) or Myd88-deficient ( Myd88 -/- ) mice were tested for TNF responses to various TLR ligands. Values represent mean s.e.m. (n=6 mice or more). The inducers used were smooth LPS (a), rough LPS (b), lipid A (c), S-MALP-2 (e), LTA (f), zymosan A (g), Pam 2 CSK 4 (h), poly(I:C) (i), resiquimod (j), Pam 3 CSK 4 (k) and CpG-containing DNA (l). Similar results were observed in three independent experiments. Figure reproduced from reference ( 1 ).

The heedless phenotype was identified in a screen of homozygous ENU-induced G3 mutant mice for impaired response to Toll-like receptor (TLR) ligands (TLR Signaling Screen) (1).  Peritoneal macrophages from heedless mice fail to produce tumor necrosis factor (TNF)-α in response to Salmonella minnesota smooth lipopolysaccharide (LPS) chemotypes, but not rough LPS chemotype or lipid A (Figure 1).  Macrophage-activating lipopeptide-2 (MALP-2), Pam₂CSK₄, lipoteichoic acid (LTA) and zymosan A (all TLR2/6 ligands) elicit partially impaired TNF-α production from heedless macrophages.  In contrast, TNF-α production is normal in response to other TLR ligands including Pam₃CSK₄ (TLR2/1), resiquimod (TLR7), poly I:C (TLR3) and unmethylated CpG oligodeoxynucleotides (TLR9).  Thus, heedless mice exhibit a ligand-specific TLR4 signaling defect, and a reduction of TLR2/6-mediated signaling.  Surprisingly, heedless mice were resistant to shock induced by intaperitoneal injection (1 mg) of either smooth or rough LPS chemotypes.

 

Lipid A fails to induce type I interferon (IFN) production and expression of IFN-inducible genes in heedless macrophages in vitro.  IRF-3 phosphodimer formation does not occur, but NF-κB and MAP kinase activation are normal.  Type I IFN production is also abrogated in response to smooth LPS in mutant macrophages.  In vivo, smooth LPS administered intraperitoneally elicits no type I IFN or TNF-α production in the serum of heedless mice.  In contrast, treatment with rough LPS results in TNF-α but not type I IFN production.  Therefore, heedless prevents all TLR4-dependent type I IFN responses, but only smooth (not rough) LPS-induced TNF-α production (1).

 

The response to vesicular stomatitis virus (VSV) depends on type I IFN, and heedless macrophages are more sensitive to cytolysis, accumulate higher viral titers, and produce far less IFN-α upon VSV infection compared to wild type macrophages.  VSV-induced IRF-3 activation is reduced in heedless cells.  Pretreatment of heedless macrophages with IFN-β prior to VSV infection prevents the lytic effect of infection.

 

Nature of Mutation

The heedless mutation was mapped to Chromosome 18, and corresponds to a C to T transition at position 1013 of the Cd14 transcript, in exon 2 of 2 total exons.

 

998 TTCACTGGGCTGAAGCAGGTACCTAAAGGGCTG

279 -F--T--G--L--K--Q--V--P--K--G--L-...

                                                       deleted

 

The mutated nucleotide is indicated in red lettering, and creates a premature stop codon in place of glutamine 284 resulting in deletion of 83 amino acids from the C terminus of the protein.

Protein Prediction

Figure 2. Domain structure of CD14. The heedless mutation creates a premature stop codon in place of glutamine at amino acid 284. Predicted N-glycosylation sites are noted in pink ovals. SP, signal peptide; LRR, leucine-rich repeat; GPI, glycosylphosphatidylinositol.

Figure 3. Crystal structure of the mouse CD14 dimer. The two monomers of CD14 are shown in cyan and dark blue. β-strands are represented by flat arrows and α-helices by coils. LPS binds to the N-terminal hydrophobic pockets (black arrows). UCSF Chimera structure is based on PDB 1WWL, Kim et al, L.Biolo.Chem 280, 11347-11351 (2005). Click on the 3D structure to view it rotate.

CD14 is a 366 amino acid transmembrane protein that functions as a receptor for multiple ligands. Mouse and human CD14 are 73% identical at the cDNA level, and 66% identical at the amino acid level (2;3) (Figure 2).  CD14 contains a signal sequence followed by a cleavage site at its N terminus (4).  No intracellular signaling domain is found in CD14, nor a typical hydrophobic region that might serve as a membrane anchor (4;5).  CD14 is linked to the membrane by a glycosylphosphatidylinositol (GPI) linker at its C terminus, and is also found in soluble form in serum and in the culture media of CD14-expressing cells (5;6).  Both soluble and membrane-attached forms possess biological activity (7;8).  Mouse CD14 contains five potential N-glycosylation sites (2;4). Similar to Toll-like receptors (TLRs), CD14 contains 10 leucine-rich repeats (LRRs) with consensus sequence LXXLXLX (2;4).  The crystal structure of mouse CD14 is a horseshoe-shaped structure formed by thirteen β strands (11 parallel and 2 antiparallel) on the concave face and seven α helices and several loops on the convex face (9).  Eleven of the thirteen β strands are formed by sequences containing LRRs.  In the crystal, CD14 forms an asymmetric dimer that is postulated to form a structure similar to that of TLR4 (9) (Figure 3).

 

Mapping of the LPS binding surfaces on mouse CD14 by various methods including antibody epitope mapping and mutagenesis have identified four regions within the 65 N-terminal amino acids required for binding and/or signaling (10).  These four regions are hydrophilic (10), and by analysis of the crystal structure, cluster around a hydrophobic pocket formed by the protein N-terminus (9).  This pocket is hypothesized to be the binding site for the lipid component of LPS based on the fact that antibodies that block LPS binding map to the area of the N-terminal hydrophobic pocket, and that the pocket is the only hydrophobic surface large enough to fit the lipid portion of LPS (9).  The LRR motifs of TLRs often mediate ligand recognition such as can be observed in the structure of TLR2 bound to Pam₃CSK₄ (11), in which a hydrophobic pocket also mediates binding. It is likely that the hydrophilic carbohydrate chain of LPS binds to site(s) distinct from the hydrophobic pocket, since deacylated LPS can still bind to CD14 (12).  Grooves created by the LRRs and loops on the convex surface of CD14 may also serve as binding sites for hydrophilic portions of LPS.

 

The heedless mutation creates a stop codon in place of glutamine 284, truncating the C-terminal 83 amino acids of CD14 just after the ninth LRR.  This protein lacks the tenth LRR and the site for attachment of the GPI membrane anchor (6).  When expressed in Chinese hamster ovary cells, a recombinant truncation mutant containing only amino acids 1-152 of CD14 had biological activity equivalent to full length soluble CD14 (7), suggesting that CD14 with the heedless mutation might also have some function.  However, the same study found that of ten mutants with truncations of varying length, only four could be stably expressed; mutants lacking either the ninth and tenth, or the tenth LRR alone, could not be expressed at detectable levels (7).  Thus, Cd14^heedless likely encodes an unstable protein that is degraded by the cell.  This is supported by the fact that Cd14^-/- macrophages display the same phenotype as heedless macrophages, and that recombinant soluble CD14 rescues heedless phenotypes when added to macrophage cultures (1).

Expression/Localization

CD14 expression is restricted to cells of the myeloid lineage, including monocytes, macrophages and granulocytes (4;13).  It is found attached to the cell membrane by a GPI-anchor and may also be released from cells as a soluble protein (5).

Background

CD14 was identified in the early 1980s as a 55 kd monocyte-specific antigen against which mice immunized with human peripheral blood adherent cells produced antibodies (13).  CD14 expression was found to be restricted to mature monocytes/macrophages, and was therefore thought to be a developmental marker expressed late in myeloid differentiation and possibly possessing some effector function (13).  The function of CD14 was later shown to be as a receptor for LPS in association with lipopolysaccharide binding protein (LBP) (14).  LBP is a serum glycoprotein that binds bacterial LPS and enhances its attachment to macrophages, leading to TNF-α and other cytokine production by macrophages (15;16).  CD14-blocking antibodies prevented both macrophages and heparinized human blood from producing TNF-α in response to LPS-LBP complexes or LPS, respectively (14).  Thus, CD14 was concluded to be the macrophage receptor for the LPS-LBP complex (14).

 

Support for the physiological function of CD14 as a component of the LPS receptor came from experiments using transgenic mice expressing human CD14, and from mice with targeted deletion of CD14.  Mice expressing Cd14 under the control of a Moloney murine leukemia virus promoter show CD14 expression in peripheral blood monocytes, peritoneal and bone marrow macrophages, neutrophils and Thy-1⁺ T lymphocytes (17).  When challenged intraperitoneally with Salmonella minnesota, transgenic mice display increased mortality compared to non-transgenic mice, with 38.2% of transgenic mice dying from LPS-induced endotoxin shock in response to a low dose of  LPS (5 μg/g body weight) in comparison to zero non-transgenic mice deaths (17).  Conversely, Cd14^-/- mice are resistant, and show no signs of endotoxin shock, to a dose of LPS (20 mg/kg body weight) or E. coli 011:B4 (5 x 10⁶ cfu) that produces 100% lethality in control mice (18).  It should be noted that E. coli in this quantity might cause death not through infection per se, but as a result of acute LPS toxicity.  LPS injection also fails to induce TNF-α and IL-6 production from Cd14^-/- mice (18).  Interestingly, at ten times the LD₁₀₀ of control mice (200 mg/kg body weight), Cd14^-/- mice show signs of endotoxemia, and when initially sensitized by administration of D-galactosamine, all Cd14^-/- mice tested died (18).  Thus, CD14 is an important mediator of bacteria- and LPS-induced shock.  However, at high doses of LPS, cytokine production and shock responses can apparently be induced by mechanisms not requiring CD14.

 

As mentioned above (Protein Prediction), CD14 exists as both a soluble and GPI-linked membrane protein with no intracellular signaling domain.  Soluble CD14 can provide cells normally lacking CD14, such as endothelial cells, with the ability to respond to LPS (8;19).  Recombinant soluble CD14 provided in the culture medium also allows Cd14^-/- peripheral blood mononuclear cells to respond to LPS by secreting TNF-α, although at lower levels than wild type macrophages (18).  These data, together with experiments demonstrating that anti-CD14 antibodies that do not block LPS binding still inhibit cellular responses to LPS (20), suggest that an LPS-CD14 complex does not transduce an intracellular signal on its own, but interacts with other membrane molecules to mediate signaling.

 

A single nucleotide polymorphism (C to T) in the proximal CD14 promoter occurs at position -159 from the transcription start site (21) (OMIM 158120).  A homozygous T genotype at this position is reported to be associated with significantly higher levels of serum soluble CD14 than the CC or CT genotype (21).  The TT genotype is also associated with an increased risk of myocardial infarction, possibly due to increased inflammation driven by CD14-dependent activation of monocytes (22).  How the T allele affects the function of CD14 remains unknown, but may contribute to transcriptional regulation of CD14.

Putative Mechanism

Figure 3. CD14, along with MD-2, is required for TLR4 to recognize LPS and VSV-G, leading to TLR4 signaling and pro-inflammatory responses. This image is interactive. Click on the image to view mutations found within the pathway (red) and the genes affected by these mutations (black). Click on the mutations for more specific information.

While multiple receptors and receptor complexes have been implicated in LPS recognition (23), it is now known that TLR4 (see record for lps3), together with MD-2, is absolutely required for LPS recognition and signaling leading to pro-inflammatory responses (24) (Figure 4).  However, whether and how CD14 interacts with TLR4 to transduce LPS-induced signals is still incompletely understood.  Studies using fluorescence recovery after photobleaching (FRAP) suggest that LPS briefly associates with CD14 before being transferred to an immobile receptor or receptor complex (25).  The technique measures the recovery of fluorescence in a small area of cell membrane after photobleaching.  Fluorescently-tagged LPS or CD14 is expressed in the cell, and the recovery of fluorescence is a measure of the diffusion rate of LPS or CD14 in the membrane.  After LPS ligation, the diffusion coefficient of CD14 is unchanged, and differs from that of LPS which is rapidly immobilized (25).  In another study using LPS that could be crosslinked to binding partners using UV light, it was shown that LPS can only be crosslinked to TLR4 and MD-2 when CD14 is present (26).  These data support the conclusion that CD14 serves to bind and transfer LPS and/or other ligands to membrane receptors that initiate intracellular signaling.

 

The heedless phenotype reveals several previously unknown functions of CD14: CD14 is required for LPS-induced activation of the Trif-Tram pathway and is at least partially required for the response to TLR2/6 activation.  Consistent with its importance for Trif-Tram signaling, CD14 is required for IRF-3 activation and IFN-β production stimulated by VSV infection.  CD14 also permits the TLR4-MD-2 complex to sense both smooth and rough LPS chemotypes.  LPS consists of a lipid A moiety, a core polysaccharide and an O-polysaccharide of variable length.  Rough LPS lacks the O-polysaccharide chain, while smooth LPS has long O-polysaccharide chains.  The protein LBP binds to both smooth and rough LPS (27), and CD14 must do so as well, since only in its absence does TLR4-MD-2 distinguish between the chemotypes.

 

It is possible, though not yet certain, that CD14 may physically interact with TLR4-MD-2 on the cell surface in the presence of LPS, coordinating the spatial organization of TLR4-MD-2 complexes so as to permit Trif-Tram recruitment by the cytoplasmic domains of the TLR4 moiety.  In this view of the events that occur during LPS receptor activation, TLR4 would have at least two (and perhaps more) qualitatively distinct signaling conformations, alternatively adopted in response to different events occurring on the outside of the plasma membrane.

Primers

Primers cannot be located by automatic search.

Genotyping

Heedless genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide change.

 

Primers for PCR amplification

Heed(F): 5’-TCTTCCCTGCCCTCTCCACCTTAG -3’

Heed(R): 5’-CGGTGACTACGCCAGAGTTAAACTTCTC -3’

 

PCR program

1) 94°C             2:00

2) 94°C             0:15

3) 60°C             0:20

4) 68°C             1:00

5) repeat steps (2-4) 35X

6) 68°C             5:00

7) 4°C              ∞

 

Primers for sequencing

Heed_seq(F): 5’- TTGGGCGAGAGAGGACTGATCTC -3’

Heed_seq(R): 5’- CGCCAGAGTTAAACTTCTCCGAG -3’

 

The following sequence of 462 nucleotides (from Genbank genomic region NC_000084 for linear DNA sequence of Cd14) is amplified:

 

 817                                        tctt ccctgccctc tccaccttag

 841 acctgtctga caatcctgaa ttgggcgaga gaggactgat ctcagccctc tgtcccctca

 901 agttcccgac cctccaagtt ttagcgctgc gtaacgcggg gatggagacg cccagcggcg

 961 tgtgctctgc gctggccgca gcaagggtac agctgcaagg actagacctt agtcacaatt

1021 cactgcggga tgctgcaggc gctccgagtt gtgactggcc cagtcagcta aactcgctca

1081 atctgtcttt cactgggctg aagcaggtac ctaaagggct gccagccaag ctcagcgtgc

1141 tggatctcag ttacaacagg ctggatagga accctagccc agatgagctg ccccaagtgg

1201 ggaacctgtc acttaaagga aatccctttt tggactctga atcccactcg gagaagttta

1261 actctggcgt agtcaccg

 

PCR primer binding sites are underlined; sequencing primer binding sites are highlighted in gray; the mutated C is shown in red text.

References

   1.  Jiang, Z., Georgel, P., Du, X., Shamel, L., Sovath, S., Mudd, S., Huber, M., Kalis, C., Keck, S., Galanos, C., Freudenberg, M., and Beutler, B. (2005) CD14 is required for MyD88-independent LPS signaling, Nat. Immunol. 6, 565-570.

   2.  Matsuura, K., Setoguchi, M., Nasu, N., Higuchi, Y., Yoshida, S., Akizuki, S., and Yamamoto, S. (1989) Nucleotide and amino acid sequences of the mouse CD14 gene, Nucleic Acids Res. 17, 2132.

   3.  Ferrero, E. and Goyert, S. M. (1988) Nucleotide sequence of the gene encoding the monocyte differentiation antigen, CD14, Nucleic Acids Res. 16, 4173.

   4.  Ferrero, E., Hsieh, C. L., Francke, U., and Goyert, S. M. (1990) CD14 is a member of the family of leucine-rich proteins and is encoded by a gene syntenic with multiple receptor genes, J Immunol. 145, 331-336.

   5.  Haziot, A., Chen, S., Ferrero, E., Low, M. G., Silber, R., and Goyert, S. M. (1988) The monocyte differentiation antigen, CD14, is anchored to the cell membrane by a phosphatidylinositol linkage, J Immunol. 141, 547-552.

   6.  Durieux, J. J., Vita, N., Popescu, O., Guette, F., Calzada-Wack, J., Munker, R., Schmidt, R. E., Lupker, J., Ferrara, P., Ziegler-Heitbrock, H. W., and . (1994) The two soluble forms of the lipopolysaccharide receptor, CD14: characterization and release by normal human monocytes, Eur. J Immunol. 24, 2006-2012.

   7.  Juan, T. S., Kelley, M. J., Johnson, D. A., Busse, L. A., Hailman, E., Wright, S. D., and Lichenstein, H. S. (1995) Soluble CD14 truncated at amino acid 152 binds lipopolysaccharide (LPS) and enables cellular response to LPS, J Biol. Chem. 270, 1382-1387.

   8.  Frey, E. A., Miller, D. S., Jahr, T. G., Sundan, A., Bazil, V., Espevik, T., Finlay, B. B., and Wright, S. D. (1992) Soluble CD14 participates in the response of cells to lipopolysaccharide, J Exp. Med. 176, 1665-1671.

   9.  Kim, J. I., Lee, C. J., Jin, M. S., Lee, C. H., Paik, S. G., Lee, H., and Lee, J. O. (2005) Crystal structure of CD14 and its implications for lipopolysaccharide signaling, J. Biol. Chem. 280, 11347-11351.

 10.  Cunningham, M. D., Shapiro, R. A., Seachord, C., Ratcliffe, K., Cassiano, L., and Darveau, R. P. (2000) CD14 employs hydrophilic regions to "capture" lipopolysaccharides, J Immunol. 164, 3255-3263.

 11.  Jin, M. S., Kim, S. E., Heo, J. Y., Lee, M. E., Kim, H. M., Paik, S. G., Lee, H., and Lee, J. O. (2007) Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide, Cell 130, 1071-1082.

 12.  Kitchens, R. L. and Munford, R. S. (1995) Enzymatically deacylated lipopolysaccharide (LPS) can antagonize LPS at multiple sites in the LPS recognition pathway, J Biol. Chem. 270, 9904-9910.

 13.  Todd, R. F., III, Nadler, L. M., and Schlossman, S. F. (1981) Antigens on human monocytes identified by monoclonal antibodies, J Immunol. 126, 1435-1442.

 14.  Wright, S. D., Ramos, R. A., Tobias, P. S., Ulevitch, R. J., and Mathison, J. C. (1990) CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein, Science 249, 1431-1433.

 15.  Wright, S. D., Tobias, P. S., Ulevitch, R. J., and Ramos, R. A. (1989) Lipopolysaccharide (LPS) binding protein opsonizes LPS-bearing particle for recognition by a novel receptor on macrophages, J. Exp. Med. 170, 1231-1241.

 16.  Schumann, R. R., Leong, S. R., Flaggs, G. W., Gray, P. W., Wright, S. D., Mathison, J. C., Tobias, P. S., and Ulevitch, R. J. (1990) Structure and function of lipopolysaccharide binding protein, Science 249, 1429-1431.

 17.  Ferrero, E., Jiao, D., Tsuberi, B. Z., Tesio, L., Rong, G. W., Haziot, A., and Goyert, S. M. (1993) Transgenic mice expressing human CD14 are hypersensitive to lipopolysaccharide, Proc. Natl. Acad. Sci. ,USA 90, 2380-2384.

 18.  Haziot, A., Ferrero, E., Kontgen, F., Hijiya, N., Yamamoto, S., Silver, J., Stewart, C. L., and Goyert, S. M. (1996) Resistance to endotoxin shock and reduced dissemination of gram-negative bacteria in CD14-deficient mice., Immunity 4, 407-414.

 19.  Haziot, A., Rong, G. W., Silver, J., and Goyert, S. M. (1993) Recombinant soluble CD14 mediates the activation of endothelial cells by lipopolysaccharide, J Immunol. 151, 1500-1507.

 20.  Lee, J. D., Kravchenko, V., Kirkland, T. N., Han, J., Mackman, N., Moriarty, A., Leturcq, D., Tobias, P. S., and Ulevitch, R. J. (1993) Glycosyl-phosphatidylinositol-anchored or integral membrane forms of CD14 mediate identical cellular responses to endotoxin, Proc. Natl. Acad. Sci. U. S. A 90, 9930-9934.

 21.  Baldini, M., Lohman, I. C., Halonen, M., Erickson, R. P., Holt, P. G., and Martinez, F. D. (1999) A Polymorphism* in the 5' flanking region of the CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E, Am. J Respir. Cell Mol. Biol. 20, 976-983.

 22.  Shimada, K., Watanabe, Y., Mokuno, H., Iwama, Y., Daida, H., and Yamaguchi, H. (2000) Common polymorphism in the promoter of the CD14 monocyte receptor gene is associated with acute myocardial infarction in Japanese men, Am. J Cardiol. 86, 682-4, A8.

 23.  Triantafilou, M. and Triantafilou, K. (2002) Lipopolysaccharide recognition: CD14, TLRs and the LPS-activation cluster, Trends Immunol. 23, 301-304.

 24.  Poltorak, A., He, X., Smirnova, I., Liu, M.-Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M. A., Ricciardi-Castagnoli, P., Layton, B., and Beutler, B. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene, Science 282, 2085-2088.

 25.  Triantafilou, K., Triantafilou, M., Ladha, S., Mackie, A., Dedrick, R. L., Fernandez, N., and Cherry, R. (2001) Fluorescence recovery after photobleaching reveals that LPS rapidly transfers from CD14 to hsp70 and hsp90 on the cell membrane, J Cell Sci. 114, 2535-2545.

 26.  da Silva, C. J., Soldau, K., Christen, U., Tobias, P. S., and Ulevitch, R. J. (2001) Lipopolysaccharide is in close proximity to each of the proteins in its membrane receptor complex. transfer from CD14 to TLR4 and MD-2, J Biol. Chem. 276, 21129-21135.

 27.  Tobias, P. S., Soldau, K., and Ulevitch, R. J. (1989) Identification of a lipid A binding site in the acute phase reactant lipopolycaccharide binding protein., J. Biol. Chem. 264, 10867-10871.