Phenotypic Mutation 'Ketogenic'

• Allele: Ketogenic
• Mutation Type: missense
• Chromosome: 15
• Coordinate: 81,122,069 bp (GRCm39)
• Base Change: A ⇒ G (forward strand)
• Gene: Mchr1
• Gene Name: melanin-concentrating hormone receptor 1
• Synonym(s): Mch1r, Gpr24, Gpr24-9, MCH-1R, melanin-concentrating hormone receptor 1
• Chromosomal Location: 81,119,700-81,123,165 bp (+) (GRCm39)
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Homozygous mice for some alleles may display osteoporosis, resistance to diet-induced obesity, abnormal pyramidal neuron physiology, hyperactivity, polyphagia, increased heart rate and body temperature, sleep behavior, and impaired conditioned learning. [provided by MGI curators]
• Mapped: Yes
• Amino Acid Change: Tyrosine changed to Cysteine
• Institutional Source: Beutler Lab
• Gene Model: predicted gene model for protein(s): [ENSMUSP00000126191]
• AlphaFold: Q8JZL2
• SMART Domains: Protein: ENSMUSP00000126191; Gene: ENSMUSG00000050164; AA Change: Y273C

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	48	184	4e-6	PFAM
Pfam:7TM_GPCR_Srsx	51	325	3.6e-10	PFAM
Pfam:7tm_1	57	311	2.4e-45	PFAM

• Predicted Effect: probably damaging ; PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
  (Using ENSMUST00000166855)
• Meta Mutation Damage Score: 0.7303
• Is this an essential gene?: Probably nonessential (E-score: 0.080)
• Phenotypic Category: Unknown
• Mode of Inheritance: Unknown
• Last Updated: 2019-09-04 9:32 PM by Anne Murray
• Record Created: 2019-01-03 12:51 AM by Bruce Beutler
• Record Posted: 2019-04-02
• Science Writers: Anne Murray
• Illustrators: Diantha La Vine
• Authors: Zhao Zhang and Bruce Beutler

Accession Number

NCBI RefSeq: NM_145132; MGI:2180756

Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (other)(1) Radiation induced(2) Targeted(11)

Phenotypic Description

Figure 1. Ketogenic mice exhibited reduced body weights. Scaled weights are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Ketogenic phenotype was identified among G3 mice of the pedigree R6516, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 64 mutations (X-axis) identified in the G1 male of pedigree R6516. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 64 mutations. The body weight phenotype was linked to a mutation in Mchr1:  an A to G transition at base pair 81,237,868 (v38) on chromosome 15, or base pair 2,370 in the GenBank genomic region NC_000081.  The strongest association was found with an additive model of inheritance, wherein 11 variant homozygotes and 34 heterozygous mice departed phenotypically from 25 homozygous reference mice with a P value of 2.095 x 10^-5 (Figure 2).  

The mutation corresponds to residue 1,093 in the mRNA sequence NM_145132 within exon 2 of 2 total exons.

1077 TGCTGGGCGCCCTACTACGTGCTGCAGCTGACC 268  -C--W--A--P--Y--Y--V--L--Q--L--T-

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to cysteine substitution at position 273 (Y273C) in the MCHR1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.999).

Protein Prediction

Figure 3. Domain organization of MCHR1. MCHR1 is a G protein-coupled receptor with an extracellular N-terminus and an intracellular C-terminus. The Ketogenic mutation results in a tyrosine to cysteine substitution at position 273. Abbreviations: TM, transmembrane domain; ICL, intracellular loop; ECL, extracellular loop.

Figure 4. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, GPCR undergoes confirmational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis of GTP to GDP by RGS leads to inactivation of the G-protein.

Mchr1 encodes melanin-concentrating hormone (MCH) receptor 1 (MCHR1; alternatively, MCH-1R, SLC-1, or GPR24), a G protein-coupled receptor (GPCR). MCHR1 belongs to the γ-group of rhodopsin (see the record for bemr3) family class A GPCRs. GPCRs have seven transmembrane helices connected by loops, and ligand binding occurs at extracellular loops facilitated by specific transmembrane helices (Figure 3). The N-terminus is extracellular, while the C-terminus is intracellular. As a GPCR, MCHR1 couples with a heterotrimeric G protein (Gi/o and Gq) to mediate its downstream effects. G proteins consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex. In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated (Figure 4). Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit. GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and one that may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. 

The essentiality of several amino acids throughout the length of MCHR1 has been determined. For example, multiple residues in the second intracellular loop (i.e., amino acids 150 to 158), third intracellular loop (i.e., amino acids 234, 242, 243, and 257), and fifth transmembrane domain (i.e., amino acids 228 and 229) are responsible for determining the Gi/o versus Gq G protein preference (1). Mutation of the residues results in impaired Gi/o activation, but does not affect Gq activation. Asp123 within the third transmembrane domain is required for ligand binding (2). Arg155 within the second intracellular loop is required for GPCR-associated signaling (3). An Asp-Arg-Tyr (DRY) motif (amino acids 140 to 142) regulates receptor conformation and dual G protein coupling (4). Pro377 and Arg210 are required for MCH-associated signaling (5). P377S and R210H mutations, which have been identified in underweight individuals, resulted in a failure to response to MCH, but did not alter cell surface expression of MCHR1. Within the C-terminal tail, Arg319 and Lys320 are essential for Gi/o- and Gq-mediated signaling (6), while Thr317, Ser325, and Thr342 are required for MCH-induced receptor internalization (7;8).

MCHR1 undergoes several post-translational modifications. N-linked glycosylation of Asn13, Asn16, and Asn23 is required for MCHR1 trafficking to the cell surface (9). MCHR1 has nine predicted phosphorylation sites: Ser158 and Thr255 (by protein kinase A); Ser151, Ser243, Ser246, Thr251, Thr317, and Ser325 (by protein kinase C); and Thr342 (by casein kinase 2) (7). Phosphorylation of Thr317, Ser325, and Thr342 regulate MCH-induced receptor internalization (8). Phosphorylation of Thr255, at the junction of the third intracellular loop and sixth transmembrane domain, is necessary for receptor folding and trafficking to the cell surface (10). The significance of the other putative phosphorylation sites is unknown.

Several proteins interact with MCHR1, including periplakin, neurochondrin, and RGS8. Periplakin and neurochondrin interact with the proximal C-terminus, reducing calcium mobilization initiation (11;12). RGS8 is a GTPase-activating protein for Gα subunits that interacts with Arg253 and Arg256 within the distal end of the third cytoplasmic loop of MCHR1, negatively regulating MCHR1 function (13).

The Ketogenic mutation results in a tyrosine to cysteine substitution at position 273 (Y273C). Amino acid 273 is within the sixth transmembrane domain.

Expression/Localization

MCHR1 is predominantly expressed in the brain (1;14;15). MCHR1 is also expressed in pituitary and adrenal glands as well as tumor tissues of adrenocortical tumors, pheochromocytoma, ganglioneuroblastoma, and neuroblastoma (15). MCHR1 mRNA in rats was expressed in the olfactory nerve layer, olfactory nucleus, tubercle, hippocampal formation, septum, amygdala, and nucleus accumbens shell (16).

Background

Figure 5. MCHR1-associated signaling pathways. MCHR1 can couple to either G i , G 0 , or G q/11 G proteins. Activation of G i causes reduced adenylate cyclase activity and reduced cAMP formation. Activation of G 0 (not shown) or G q/11 results in Ras/Raf activation and subsequent MAPK activation as well as activation of IP 3 and PLC/PKC and subsequent increased Ca 2+ concentrations. Activation of MCHR1-associated signaling ultimately leads to changes in gene transcription and cell proliferation. Adapted from Presse et al.

MCHR1 is a receptor for MCH, a neuropeptide (1;17). MCH functions in several behaviors, including feeding, body weight regulation, anxiety, sleep regulation, and reward behavior. MCHR1 stimulation results in activation of several signaling pathways, resulting in calcium mobilization (via the Gi/o- and Gq-coupled pathways), ERK phosphorylation, and inhibition of cyclic AMP generation (via the Gi/o-coupled pathway) (Figure 5) (1;17;18).

Overall, loss of MCH-associated signaling in the mouse results in increased locomotor activity, aggression, and male sexual behavior as well as suppression of non-REM sleep, anxiety, responses to novelty, startle responses, and conditioned place preferences (19-22). Loss of MCH-associated signaling also results in increased food intake, body temperature, activity, oxygen consumption, heart rate, and mean arterial pressure as well as suppression of body weight, fat mass, and plasma leptin levels (for more information about leptin, see the record for potbelly) (19-26). Most Mchr1-deficient (Mchr1^-/-) mouse models showed reduced susceptibility to diet-induced obesity and increased weight loss in response to food deprivation compared to wild-type mice (24-29). Mchr1^-/- mice showed increased foraging behaviors as well as more food-directed responses when the response requirement to obtain food was increased (30). Some Mchr1^-/- mice showed reduced circulating levels of iodothyronine with concomitant increased levels of thyrotropin-releasing hormone and thyrotropin-releasing factor, indicating aberrant thyroid function (31). Both α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and N-methyl-d-aspartate (NMDA) receptor-mediated transmissions were reduced in the Mchr1^-/- mice (32). Also, long-term synaptic potentiation and long-term synaptic depression were reduced in the Mchr1^-/- mice (32).

Putative Mechanism

Figure 6. Downstream effects of leptin. Agrp/Npy neurons and Pomc/Cart neurons are located in the arcuate nucleus of the hypothalamus and are regulated by leptin from adipose tissue. Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons in the hypothalamus. Agouti and Agrp are hypothalamus-specific antagonists of MC3R and MC4R while α-MSH, a proteolytic product of Pomc, is a known agonist of MC3R and MC4R. Agrp and Npy stimulate food intake and decrease energy expenditures, causing weight gain. Pomc and Cart inhibit food intake and increase energy expenditure. Agrp, Agouti-related protein; Agrp, producing Agrp; Npy, neuropeptide Y; Pomc, pro-opiomelanocortin; Cart, cocaine- and amphetamine-regulated transcript; α-MSH, α-melanocyte stimulating hormone; LEPR, leptin receptor. This image is interactive. Other mutations found in the pathway are noted in red. Click on each allele for more information.

The reduced body weight phenotype observed in the Ketogenic mice mimics that observed in Mchr1^-/- mice, indicating loss of MCHR1-associated function. MCHR1-associated signaling results in increased Lep mRNA synthesis and leptin secretion. Although the Mchr1^-/- mice have increased food intake, body weight gain, fat mass, and plasma leptin levels are suppressed. Leptin is a hormone that regulates several functions in the body (see potbelly), including regulation of energy expenditure, food intake, weight loss, and diabetes (Figure 6).

Primers

PCR Primer
Ketogenic_pcr_F: ACTCCTGTGTGGCTCTATGC
Ketogenic_pcr_R: TCTGAGCATTGCTGACCGTG

Sequencing Primer
Ketogenic_seq_F: ACCCAGATACTGATCTTTACTGG
Ketogenic_seq_R: ATTGCTGACCGTGCGAAG

Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 499 nucleotides is amplified (chromosome 15, + strand):

1   actcctgtgt ggctctatgc caggcttatc cccttcccag ggggtgctgt gggctgtggc
61  atccgcctac caaacccaga tactgatctt tactggttca ctctgtatca gtttttcctg
121 gccttcgccc ttccgtttgt ggtcatcact gctgcgtacg tgaaaatact acagcgcatg
181 acgtcttcgg tggccccagc ctctcaacgc agcatccggc ttcggacaaa gagggtgacc
241 cgcacagcca ttgccatctg tctggtcttc tttgtgtgct gggcgcccta ctacgtgctg
301 cagctgaccc agttgtccat cagccgcccg accctcacat tcgtctacct gtacaatgcg
361 gctatcagct tgggctatgc caacagctgc ctcaatccct ttgtgtacat agtactctgt
421 gagacctttc gaaaacgctt ggtgctgtcg gtgaagcccg cggcccaggg gcagcttcgc
481 acggtcagca atgctcaga

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References

  1. Saito, Y., Nothacker, H. P., Wang, Z., Lin, S. H., Leslie, F., and Civelli, O. (1999) Molecular Characterization of the Melanin-Concentrating-Hormone Receptor. Nature. 400, 265-269.

  2. Macdonald, D., Murgolo, N., Zhang, R., Durkin, J. P., Yao, X., Strader, C. D., and Graziano, M. P. (2000) Molecular Characterization of the Melanin-Concentrating hormone/receptor Complex: Identification of Critical Residues Involved in Binding and Activation. Mol Pharmacol. 58, 217-225.

  3. Saito, Y., Tetsuka, M., Saito, S., Imai, K., Yoshikawa, A., Doi, H., and Maruyama, K. (2005) Arginine Residue 155 in the Second Intracellular Loop Plays a Critical Role in Rat Melanin-Concentrating Hormone Receptor 1 Activation. Endocrinology. 146, 3452-3462.

  4. Aizaki, Y., Maruyama, K., Nakano-Tetsuka, M., and Saito, Y. (2009) Distinct Roles of the DRY Motif in Rat Melanin-Concentrating Hormone Receptor 1 in Signaling Control. Peptides. 30, 974-981.

  5. Goldstein, C., Schroeder, J. C., Fortin, J. P., Goss, J. M., Schaus, S. E., Beinborn, M., and Kopin, A. S. (2010) Two Naturally Occurring Mutations in the Type 1 Melanin-Concentrating Hormone Receptor Abolish Agonist-Induced Signaling. J Pharmacol Exp Ther. 335, 799-806.

  6. Tetsuka, M., Saito, Y., Imai, K., Doi, H., and Maruyama, K. (2004) The Basic Residues in the Membrane-Proximal C-Terminal Tail of the Rat Melanin-Concentrating Hormone Receptor 1 are Required for Receptor Function. Endocrinology. 145, 3712-3723.

  7. Saito, Y., Hamamoto, A., and Kobayashi, Y. (2013) Regulated Control of Melanin-Concentrating Hormone Receptor 1 through Posttranslational Modifications. Front Endocrinol (Lausanne). 4, 154.

  8. Saito, Y., Tetsuka, M., Li, Y., Kurose, H., and Maruyama, K. (2004) Properties of Rat Melanin-Concentrating Hormone Receptor 1 Internalization. Peptides. 25, 1597-1604.

  9. Saito, Y., Tetsuka, M., Yue, L., Kawamura, Y., and Maruyama, K. (2003) Functional Role of N-Linked Glycosylation on the Rat Melanin-Concentrating Hormone Receptor 1. FEBS Lett. 533, 29-34.

  10. Fan, J., Perry, S. J., Gao, Y., Schwarz, D. A., and Maki, R. A. (2005) A Point Mutation in the Human Melanin Concentrating Hormone Receptor 1 Reveals an Important Domain for Cellular Trafficking. Mol Endocrinol. 19, 2579-2590.

  11. Francke, F., Ward, R. J., Jenkins, L., Kellett, E., Richter, D., Milligan, G., and Bachner, D. (2006) Interaction of Neurochondrin with the Melanin-Concentrating Hormone Receptor 1 Interferes with G Protein-Coupled Signal Transduction but Not Agonist-Mediated Internalization. J Biol Chem. 281, 32496-32507.

  12. Murdoch, H., Feng, G. J., Bachner, D., Ormiston, L., White, J. H., Richter, D., and Milligan, G. (2005) Periplakin Interferes with G Protein Activation by the Melanin-Concentrating Hormone Receptor-1 by Binding to the Proximal Segment of the Receptor C-Terminal Tail. J Biol Chem. 280, 8208-8220.

  13. Miyamoto-Matsubara, M., Saitoh, O., Maruyama, K., Aizaki, Y., and Saito, Y. (2008) Regulation of Melanin-Concentrating Hormone Receptor 1 Signaling by RGS8 with the Receptor Third Intracellular Loop. Cell Signal. 20, 2084-2094.

  14. Kolakowski, L. F.,Jr, Jung, B. P., Nguyen, T., Johnson, M. P., Lynch, K. R., Cheng, R., Heng, H. H., George, S. R., and O'Dowd, B. F. (1996) Characterization of a Human Gene Related to Genes Encoding Somatostatin Receptors. FEBS Lett. 398, 253-258.

  15. Takahashi, K., Totsune, K., Murakami, O., Sone, M., Satoh, F., Kitamuro, T., Noshiro, T., Hayashi, Y., Sasano, H., and Shibahara, S. (2001) Expression of Melanin-Concentrating Hormone Receptor Messenger Ribonucleic Acid in Tumor Tissues of Pheochromocytoma, Ganglioneuroblastoma, and Neuroblastoma. J Clin Endocrinol Metab. 86, 369-374.

  16. Saito, Y., Cheng, M., Leslie, F. M., and Civelli, O. (2001) Expression of the Melanin-Concentrating Hormone (MCH) Receptor mRNA in the Rat Brain. J Comp Neurol. 435, 26-40.

  17. Chambers, J., Ames, R. S., Bergsma, D., Muir, A., Fitzgerald, L. R., Hervieu, G., Dytko, G. M., Foley, J. J., Martin, J., Liu, W. S., Park, J., Ellis, C., Ganguly, S., Konchar, S., Cluderay, J., Leslie, R., Wilson, S., and Sarau, H. M. (1999) Melanin-Concentrating Hormone is the Cognate Ligand for the Orphan G-Protein-Coupled Receptor SLC-1. Nature. 400, 261-265.

  18. Hawes, B. E., Kil, E., Green, B., O'Neill, K., Fried, S., and Graziano, M. P. (2000) The Melanin-Concentrating Hormone Receptor Couples to Multiple G Proteins to Activate Diverse Intracellular Signaling Pathways. Endocrinology. 141, 4524-4532.

  19. Takase, K., Kikuchi, K., Tsuneoka, Y., Oda, S., Kuroda, M., and Funato, H. (2014) Meta-Analysis of Melanin-Concentrating Hormone Signaling-Deficient Mice on Behavioral and Metabolic Phenotypes. PLoS One. 9, e99961.

  20. Ahnaou, A., Dautzenberg, F. M., Huysmans, H., Steckler, T., and Drinkenburg, W. H. (2011) Contribution of Melanin-Concentrating Hormone (MCH1) Receptor to Thermoregulation and Sleep Stabilization: Evidence from MCH1 (-/-) Mice. Behav Brain Res. 218, 42-50.

  21. Roy, M., David, N. K., Danao, J. V., Baribault, H., Tian, H., and Giorgetti, M. (2006) Genetic Inactivation of Melanin-Concentrating Hormone Receptor Subtype 1 (MCHR1) in Mice Exerts Anxiolytic-Like Behavioral Effects. Neuropsychopharmacology. 31, 112-120.

  22. Brommage, R., Desai, U., Revelli, J. P., Donoviel, D. B., Fontenot, G. K., Dacosta, C. M., Smith, D. D., Kirkpatrick, L. L., Coker, K. J., Donoviel, M. S., Eberhart, D. E., Holt, K. H., Kelly, M. R., Paradee, W. J., Philips, A. V., Platt, K. A., Suwanichkul, A., Hansen, G. M., Sands, A. T., Zambrowicz, B. P., and Powell, D. R. (2008) High-Throughput Screening of Mouse Knockout Lines Identifies True Lean and Obese Phenotypes. Obesity (Silver Spring). 16, 2362-2367.

  23. Lalonde, R., and Qian, S. (2007) Exploratory Activity, Motor Coordination, and Spatial Learning in Mchr1 Knockout Mice. Behav Brain Res. 178, 293-304.

  24. Astrand, A., Bohlooly-Y, M., Larsdotter, S., Mahlapuu, M., Andersen, H., Tornell, J., Ohlsson, C., Snaith, M., and Morgan, D. G. (2004) Mice Lacking Melanin-Concentrating Hormone Receptor 1 Demonstrate Increased Heart Rate Associated with Altered Autonomic Activity. Am J Physiol Regul Integr Comp Physiol. 287, R749-58.

  25. Marsh, D. J., Weingarth, D. T., Novi, D. E., Chen, H. Y., Trumbauer, M. E., Chen, A. S., Guan, X. M., Jiang, M. M., Feng, Y., Camacho, R. E., Shen, Z., Frazier, E. G., Yu, H., Metzger, J. M., Kuca, S. J., Shearman, L. P., Gopal-Truter, S., MacNeil, D. J., Strack, A. M., MacIntyre, D. E., Van der Ploeg, L. H., and Qian, S. (2002) Melanin-Concentrating Hormone 1 Receptor-Deficient Mice are Lean, Hyperactive, and Hyperphagic and have Altered Metabolism. Proc Natl Acad Sci U S A. 99, 3240-3245.

  26. Chen, Y., Hu, C., Hsu, C. K., Zhang, Q., Bi, C., Asnicar, M., Hsiung, H. M., Fox, N., Slieker, L. J., Yang, D. D., Heiman, M. L., and Shi, Y. (2002) Targeted Disruption of the Melanin-Concentrating Hormone Receptor-1 Results in Hyperphagia and Resistance to Diet-Induced Obesity. Endocrinology. 143, 2469-2477.

  27. Adamantidis, A., Thomas, E., Foidart, A., Tyhon, A., Coumans, B., Minet, A., Tirelli, E., Seutin, V., Grisar, T., and Lakaye, B. (2005) Disrupting the Melanin-Concentrating Hormone Receptor 1 in Mice Leads to Cognitive Deficits and Alterations of NMDA Receptor Function. Eur J Neurosci. 21, 2837-2844.

  28. Adamantidis, A., Salvert, D., Goutagny, R., Lakaye, B., Gervasoni, D., Grisar, T., Luppi, P. H., and Fort, P. (2008) Sleep Architecture of the Melanin-Concentrating Hormone Receptor 1-Knockout Mice. Eur J Neurosci. 27, 1793-1800.

  29. Chung, S., Wong, T., Nagasaki, H., and Civelli, O. (2010) Acute Homeostatic Responses to Increased Fat Consumption in MCH1R Knockout Mice. J Mol Neurosci. 42, 459-463.

  30. Eiler, W. J.,2nd, Chen, Y., Slieker, L. J., Ardayfio, P. A., Statnick, M. A., and Witkin, J. M. (2017) Consequences of Constitutive Deletion of Melanin-Concentrating Hormone-1 Receptors for Feeding and Foraging Behaviors of Mice. Behav Brain Res. 316, 271-278.

  31. Chung, S., Liao, X. H., Di Cosmo, C., Van Sande, J., Wang, Z., Refetoff, S., and Civelli, O. (2012) Disruption of the Melanin-Concentrating Hormone Receptor 1 (MCH1R) Affects Thyroid Function. Endocrinology. 153, 6145-6154.

  32. Pachoud, B., Adamantidis, A., Ravassard, P., Luppi, P. H., Grisar, T., Lakaye, B., and Salin, P. A. (2010) Major Impairments of Glutamatergic Transmission and Long-Term Synaptic Plasticity in the Hippocampus of Mice Lacking the Melanin-Concentrating Hormone Receptor-1. J Neurophysiol. 104, 1417-1425.