Phenotypic Mutation 'Ketogenic' (pdf version)
AlleleKetogenic
Mutation Type missense
Chromosome15
Coordinate81,237,868 bp (GRCm38)
Base Change A ⇒ G (forward strand)
Gene Mchr1
Gene Name melanin-concentrating hormone receptor 1
Synonym(s) melanin-concentrating hormone receptor 1, Gpr24-9, Gpr24, Mch1r, MCH-1R
Chromosomal Location 81,235,499-81,238,964 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the G protein-coupled receptor family 1, is an integral plasma membrane protein which binds melanin-concentrating hormone. The encoded protein can inhibit cAMP accumulation and stimulate intracellular calcium flux, and is probably involved in the neuronal regulation of food consumption. Although structurally similar to somatostatin receptors, this protein does not seem to bind somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for some alleles may display osteoporosis, resistance to diet-induced obesity, abnormal pyramidal neuron physiology, hyperactivity, polyphagia, increased heart rate and body temperature, sleep behavior, and impaired conditioned learning. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_145132; MGI:2180756

Mapped Yes 
Amino Acid Change Tyrosine changed to Cysteine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000126191]
SMART Domains Protein: ENSMUSP00000126191
Gene: ENSMUSG00000050164
AA Change: Y273C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 184 4e-6 PFAM
Pfam:7TM_GPCR_Srsx 51 325 3.6e-10 PFAM
Pfam:7tm_1 57 311 2.4e-45 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000166855)
Meta Mutation Damage Score 0.7303 question?
Is this an essential gene? Probably nonessential (E-score: 0.102) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight (Z-score) - decreased
Candidate Explorer Status CE: good candidate; Verification probability: 0.477; ML prob: 0.472; human score: -4.5
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(14) : Chemically induced (other)(1) Radiation induced(2) Targeted(11)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01834:Mchr1 APN 15 81237865 missense probably damaging 1.00
IGL02364:Mchr1 APN 15 81237279 missense probably benign 0.36
PIT4366001:Mchr1 UTSW 15 81237216 missense probably benign 0.01
R0412:Mchr1 UTSW 15 81235747 start gained probably benign
R1554:Mchr1 UTSW 15 81235820 missense probably benign 0.02
R1706:Mchr1 UTSW 15 81237163 missense probably damaging 0.99
R1771:Mchr1 UTSW 15 81237235 missense probably damaging 1.00
R5522:Mchr1 UTSW 15 81238010 missense possibly damaging 0.64
R5930:Mchr1 UTSW 15 81237843 missense probably damaging 1.00
R6516:Mchr1 UTSW 15 81237868 missense probably damaging 1.00
R6612:Mchr1 UTSW 15 81237870 missense probably damaging 0.99
R6978:Mchr1 UTSW 15 81237796 missense possibly damaging 0.90
R7583:Mchr1 UTSW 15 81237441 missense probably benign 0.29
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:32 PM by Anne Murray
Record Created 2019-01-03 12:51 AM by Bruce Beutler
Record Posted 2019-04-02
Phenotypic Description

Figure 1. Ketogenic mice exhibited reduced body weights. Scaled weights are shown. Abbreviations: REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Ketogenic phenotype was identified among G3 mice of the pedigree R6516, some of which showed reduced body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced body weights using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 64 mutations (X-axis) identified in the G1 male of pedigree R6516. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 64 mutations. The body weight phenotype was linked to a mutation in Mchr1:  an A to G transition at base pair 81,237,868 (v38) on chromosome 15, or base pair 2,370 in the GenBank genomic region NC_000081.  The strongest association was found with an additive model of inheritance, wherein 11 variant homozygotes and 34 heterozygous mice departed phenotypically from 25 homozygous reference mice with a P value of 2.095 x 10-5 (Figure 2).  

 

The mutation corresponds to residue 1,093 in the mRNA sequence NM_145132 within exon 2 of 2 total exons.

 

1077 TGCTGGGCGCCCTACTACGTGCTGCAGCTGACC

268  -C--W--A--P--Y--Y--V--L--Q--L--T-

 

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to cysteine substitution at position 273 (Y273C) in the MCHR1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.999).

Illustration of Mutations in
Gene & Protein
Protein Prediction
Figure 3. Domain organization of MCHR1. MCHR1 is a G protein-coupled receptor with an extracellular N-terminus and an intracellular C-terminus. The Ketogenic mutation results in a tyrosine to cysteine substitution at position 273. Abbreviations: TM, transmembrane domain; ICL, intracellular loop; ECL, extracellular loop.
Figure 4. GPCR activation cycle. In its inactive state, the GDP-bound α subunit and the βγ complex are associated. Upon agonist binding, GPCR undergoes confirmational change and exchanges GDP for GTP in the Gα subunit. GTP-Gα and βγ dissociate and modulate effectors. Hydrolysis
of GTP to GDP by RGS leads to inactivation of the G-protein.

Mchr1 encodes melanin-concentrating hormone (MCH) receptor 1 (MCHR1; alternatively, MCH-1R, SLC-1, or GPR24), a G protein-coupled receptor (GPCR). MCHR1 belongs to the γ-group of rhodopsin (see the record for bemr3) family class A GPCRs. GPCRs have seven transmembrane helices connected by loops, and ligand binding occurs at extracellular loops facilitated by specific transmembrane helices (Figure 3). The N-terminus is extracellular, while the C-terminus is intracellular. As a GPCR, MCHR1 couples with a heterotrimeric G protein (Gi/o and Gq) to mediate its downstream effects. G proteins consist of an α subunit that binds and hydrolyzes GTP (Gα), and β and γ subunits that are constitutively associated in a complex. In the absence of a stimulus, the GDP-bound α subunit and the βγ complex are associated (Figure 4). Upon activation by ligand binding, the GPCR recruits its cognate heterotrimeric G protein, and undergoes a conformational change enabling it to act as guanine nucleotide exchange factor (GEF) for the G protein α subunit. GEFs promote the exchange of GDP for GTP, resulting in dissociation of the GTP-bound α subunit from the activated receptor and the βγ complex. Both the GTP-bound α subunit and the βγ complex mediate signaling by modulating the activities of other proteins, such as adenylyl cyclases, phospholipases, and ion channels. Gα signaling is terminated upon GTP hydrolysis, an activity intrinsic to Gα and one that may be stimulated by GTPase activating proteins (GAPs) such as regulators of G protein signaling (RGS) proteins. The GDP-bound Gα subunit reassociates with the βγ complex and is ready for another activation cycle. 

 

The essentiality of several amino acids throughout the length of MCHR1 has been determined. For example, multiple residues in the second intracellular loop (i.e., amino acids 150 to 158), third intracellular loop (i.e., amino acids 234, 242, 243, and 257), and fifth transmembrane domain (i.e., amino acids 228 and 229) are responsible for determining the Gi/o versus Gq G protein preference (1). Mutation of the residues results in impaired Gi/o activation, but does not affect Gq activation. Asp123 within the third transmembrane domain is required for ligand binding (2). Arg155 within the second intracellular loop is required for GPCR-associated signaling (3). An Asp-Arg-Tyr (DRY) motif (amino acids 140 to 142) regulates receptor conformation and dual G protein coupling (4). Pro377 and Arg210 are required for MCH-associated signaling (5). P377S and R210H mutations, which have been identified in underweight individuals, resulted in a failure to response to MCH, but did not alter cell surface expression of MCHR1. Within the C-terminal tail, Arg319 and Lys320 are essential for Gi/o- and Gq-mediated signaling (6), while Thr317, Ser325, and Thr342 are required for MCH-induced receptor internalization (7;8).

 

MCHR1 undergoes several post-translational modifications. N-linked glycosylation of Asn13, Asn16, and Asn23 is required for MCHR1 trafficking to the cell surface (9). MCHR1 has nine predicted phosphorylation sites: Ser158 and Thr255 (by protein kinase A); Ser151, Ser243, Ser246, Thr251, Thr317, and Ser325 (by protein kinase C); and Thr342 (by casein kinase 2) (7). Phosphorylation of Thr317, Ser325, and Thr342 regulate MCH-induced receptor internalization (8). Phosphorylation of Thr255, at the junction of the third intracellular loop and sixth transmembrane domain, is necessary for receptor folding and trafficking to the cell surface (10). The significance of the other putative phosphorylation sites is unknown.

 

Several proteins interact with MCHR1, including periplakin, neurochondrin, and RGS8. Periplakin and neurochondrin interact with the proximal C-terminus, reducing calcium mobilization initiation (11;12). RGS8 is a GTPase-activating protein for Gα subunits that interacts with Arg253 and Arg256 within the distal end of the third cytoplasmic loop of MCHR1, negatively regulating MCHR1 function (13).

 

The Ketogenic mutation results in a tyrosine to cysteine substitution at position 273 (Y273C). Amino acid 273 is within the sixth transmembrane domain.

Expression/Localization

MCHR1 is predominantly expressed in the brain (1;14;15). MCHR1 is also expressed in pituitary and adrenal glands as well as tumor tissues of adrenocortical tumors, pheochromocytoma, ganglioneuroblastoma, and neuroblastoma (15). MCHR1 mRNA in rats was expressed in the olfactory nerve layer, olfactory nucleus, tubercle, hippocampal formation, septum, amygdala, and nucleus accumbens shell (16).

Background
Figure 5. MCHR1-associated signaling pathways. MCHR1 can couple to either Gi, G0, or Gq/11 G proteins. Activation of Gi causes reduced adenylate cyclase activity and reduced cAMP formation. Activation of G0 (not shown) or Gq/11 results in Ras/Raf activation and subsequent MAPK activation as well as activation of IP3 and PLC/PKC and subsequent increased Ca2+ concentrations. Activation of MCHR1-associated signaling ultimately leads to changes in gene transcription and cell proliferation. Adapted from Presse et al. 

MCHR1 is a receptor for MCH, a neuropeptide (1;17). MCH functions in several behaviors, including feeding, body weight regulation, anxiety, sleep regulation, and reward behavior. MCHR1 stimulation results in activation of several signaling pathways, resulting in calcium mobilization (via the Gi/o- and Gq-coupled pathways), ERK phosphorylation, and inhibition of cyclic AMP generation (via the Gi/o-coupled pathway) (Figure 5) (1;17;18).

 

Overall, loss of MCH-associated signaling in the mouse results in increased locomotor activity, aggression, and male sexual behavior as well as suppression of non-REM sleep, anxiety, responses to novelty, startle responses, and conditioned place preferences (19-22). Loss of MCH-associated signaling also results in increased food intake, body temperature, activity, oxygen consumption, heart rate, and mean arterial pressure as well as suppression of body weight, fat mass, and plasma leptin levels (for more information about leptin, see the record for potbelly) (19-26). Most Mchr1-deficient (Mchr1-/-) mouse models showed reduced susceptibility to diet-induced obesity and increased weight loss in response to food deprivation compared to wild-type mice (24-29). Mchr1-/- mice showed increased foraging behaviors as well as more food-directed responses when the response requirement to obtain food was increased (30). Some Mchr1-/- mice showed reduced circulating levels of iodothyronine with concomitant increased levels of thyrotropin-releasing hormone and thyrotropin-releasing factor, indicating aberrant thyroid function (31). Both α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) and N-methyl-d-aspartate (NMDA) receptor-mediated transmissions were reduced in the Mchr1-/- mice (32). Also, long-term synaptic potentiation and long-term synaptic depression were reduced in the Mchr1-/- mice (32).

Putative Mechanism
Figure 6. Downstream effects of leptin. Agrp/Npy neurons and Pomc/Cart neurons are located in the arcuate nucleus of the hypothalamus and are regulated by leptin from adipose tissue. Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons in the hypothalamus. Agouti and Agrp are hypothalamus-specific antagonists of MC3R and MC4R while α-MSH, a proteolytic product of Pomc, is a known agonist of MC3R and MC4R. Agrp and Npy stimulate food intake and decrease energy expenditures, causing weight gain. Pomc and Cart inhibit food intake and increase energy expenditure. Agrp, Agouti-related protein; Agrp, producing Agrp; Npy, neuropeptide Y; Pomc, pro-opiomelanocortin; Cart, cocaine- and amphetamine-regulated transcript; α-MSH, α-melanocyte stimulating hormone; LEPR, leptin receptor. This image is interactive. Other mutations found in the pathway are noted in red. Click on each allele for more information.

The reduced body weight phenotype observed in the Ketogenic mice mimics that observed in Mchr1-/- mice, indicating loss of MCHR1-associated function. MCHR1-associated signaling results in increased Lep mRNA synthesis and leptin secretion. Although the Mchr1-/- mice have increased food intake, body weight gain, fat mass, and plasma leptin levels are suppressed. Leptin is a hormone that regulates several functions in the body (see potbelly), including regulation of energy expenditure, food intake, weight loss, and diabetes (Figure 6).

Primers PCR Primer
Ketogenic_pcr_F: ACTCCTGTGTGGCTCTATGC
Ketogenic_pcr_R: TCTGAGCATTGCTGACCGTG

Sequencing Primer
Ketogenic_seq_F: ACCCAGATACTGATCTTTACTGG
Ketogenic_seq_R: ATTGCTGACCGTGCGAAG
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 499 nucleotides is amplified (chromosome 15, + strand):


1   actcctgtgt ggctctatgc caggcttatc cccttcccag ggggtgctgt gggctgtggc
61  atccgcctac caaacccaga tactgatctt tactggttca ctctgtatca gtttttcctg
121 gccttcgccc ttccgtttgt ggtcatcact gctgcgtacg tgaaaatact acagcgcatg
181 acgtcttcgg tggccccagc ctctcaacgc agcatccggc ttcggacaaa gagggtgacc
241 cgcacagcca ttgccatctg tctggtcttc tttgtgtgct gggcgcccta ctacgtgctg
301 cagctgaccc agttgtccat cagccgcccg accctcacat tcgtctacct gtacaatgcg
361 gctatcagct tgggctatgc caacagctgc ctcaatccct ttgtgtacat agtactctgt
421 gagacctttc gaaaacgctt ggtgctgtcg gtgaagcccg cggcccaggg gcagcttcgc
481 acggtcagca atgctcaga


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsZhao Zhang and Bruce Beutler