Incidental Mutation 'R1179:Nrbp1'
ID100216
Institutional Source Beutler Lab
Gene Symbol Nrbp1
Ensembl Gene ENSMUSG00000029148
Gene Namenuclear receptor binding protein 1
SynonymsB230344L17Rik, Nrbp
MMRRC Submission 039251-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1179 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31240864-31251566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31245813 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 210 (I210N)
Ref Sequence ENSEMBL: ENSMUSP00000143872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031034] [ENSMUST00000068997] [ENSMUST00000201259] [ENSMUST00000202505] [ENSMUST00000202576] [ENSMUST00000202842]
Predicted Effect probably damaging
Transcript: ENSMUST00000031034
AA Change: I210N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031034
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 324 5.8e-26 PFAM
Pfam:Pkinase 80 327 1e-26 PFAM
low complexity region 412 436 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068997
SMART Domains Protein: ENSMUSP00000070496
Gene: ENSMUSG00000055424

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
low complexity region 78 101 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078312
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077426
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect not run
Transcript: ENSMUST00000139602
AA Change: I194N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141973
AA Change: S309T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201070
Predicted Effect probably benign
Transcript: ENSMUST00000201259
Predicted Effect probably damaging
Transcript: ENSMUST00000202505
AA Change: I125N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144292
Gene: ENSMUSG00000029148
AA Change: I125N

DomainStartEndE-ValueType
STYKc 14 184 1.3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202576
AA Change: I210N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143872
Gene: ENSMUSG00000029148
AA Change: I210N

DomainStartEndE-ValueType
low complexity region 27 60 N/A INTRINSIC
Pfam:Pkinase 79 335 1e-24 PFAM
Pfam:Pkinase_Tyr 81 332 6.5e-25 PFAM
low complexity region 420 444 N/A INTRINSIC
low complexity region 467 484 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202801
Predicted Effect probably benign
Transcript: ENSMUST00000202842
SMART Domains Protein: ENSMUSP00000143899
Gene: ENSMUSG00000029148

DomainStartEndE-ValueType
Pfam:Pkinase 2 88 4.8e-5 PFAM
Pfam:Pkinase_Tyr 3 88 1.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202982
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.5%
  • 10x: 93.7%
  • 20x: 84.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 T A 11: 7,167,054 probably null Het
Aknad1 T C 3: 108,752,467 S266P possibly damaging Het
Gaa A T 11: 119,281,128 R686W probably damaging Het
Gls2 A T 10: 128,199,234 T79S probably damaging Het
Golga2 G T 2: 32,303,695 R511L possibly damaging Het
Hrnr T C 3: 93,332,543 S3363P unknown Het
Ift81 T C 5: 122,602,710 K187R probably benign Het
Kcnj1 T A 9: 32,396,766 I162N probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Naga T A 15: 82,330,156 N385Y probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nrip3 A G 7: 109,763,555 V163A probably damaging Het
Olfr771 A C 10: 129,160,058 S309A probably benign Het
Olfr972 T C 9: 39,874,075 S267P possibly damaging Het
Pacsin3 A G 2: 91,263,860 E378G probably damaging Het
Pnisr A G 4: 21,865,937 T309A possibly damaging Het
Rad54l A T 4: 116,111,320 L93Q probably benign Het
Ralgps2 G T 1: 156,901,799 P50Q probably damaging Het
Stab2 A G 10: 86,950,301 V594A probably damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tmem17 A T 11: 22,518,454 N131I probably damaging Het
Trrap G A 5: 144,777,939 R107H possibly damaging Het
Vmp1 T C 11: 86,607,229 T287A probably damaging Het
Zfp423 T A 8: 87,688,072 H1185L probably damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Nrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nrbp1 APN 5 31251059 missense possibly damaging 0.74
IGL00926:Nrbp1 APN 5 31243797 missense probably benign 0.07
ghetto UTSW 5 31245846 critical splice donor site probably null
pudong UTSW 5 31250137 missense probably damaging 1.00
Shanghai UTSW 5 31245813 missense probably damaging 1.00
R0358:Nrbp1 UTSW 5 31244887 missense probably damaging 1.00
R0993:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1139:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1177:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1180:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1193:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1194:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1196:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1267:Nrbp1 UTSW 5 31250590 missense probably benign 0.00
R1302:Nrbp1 UTSW 5 31249889 missense probably benign 0.00
R1320:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1321:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1322:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1323:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1324:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1325:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1341:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1388:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1411:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1448:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1697:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1815:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1816:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1950:Nrbp1 UTSW 5 31245813 missense probably damaging 1.00
R1987:Nrbp1 UTSW 5 31245391 missense probably damaging 1.00
R2079:Nrbp1 UTSW 5 31251073 missense probably benign 0.08
R2142:Nrbp1 UTSW 5 31247929 missense possibly damaging 0.95
R4299:Nrbp1 UTSW 5 31250599 critical splice donor site probably null
R5115:Nrbp1 UTSW 5 31243715 nonsense probably null
R5168:Nrbp1 UTSW 5 31250137 missense probably damaging 1.00
R5640:Nrbp1 UTSW 5 31249585 missense possibly damaging 0.96
R6765:Nrbp1 UTSW 5 31245846 critical splice donor site probably null
R7022:Nrbp1 UTSW 5 31244481 missense probably damaging 1.00
R7044:Nrbp1 UTSW 5 31249946 missense probably damaging 0.98
Predicted Primers
Posted On2014-01-15