Incidental Mutation 'R1210:Sav1'
ID100660
Institutional Source Beutler Lab
Gene Symbol Sav1
Ensembl Gene ENSMUSG00000021067
Gene Namesalvador family WW domain containing 1
SynonymsSalv, 1700040G09Rik, WW45
MMRRC Submission 039279-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1210 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69965012-69987002 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69969179 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 282 (Y282H)
Ref Sequence ENSEMBL: ENSMUSP00000021467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021466] [ENSMUST00000021467]
PDB Structure
Solution structure of the second WW domain from mouse salvador homolog 1 protein (mWW45) [SOLUTION NMR]
Solution structure of the first WW domain from the mouse salvador homolog 1 protein (SAV1) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021466
SMART Domains Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:GBP 43 314 2.3e-103 PFAM
low complexity region 350 363 N/A INTRINSIC
Blast:HAMP 468 519 9e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000021467
AA Change: Y282H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021467
Gene: ENSMUSG00000021067
AA Change: Y282H

DomainStartEndE-ValueType
WW 201 233 1.63e-8 SMART
WW 236 268 4.98e-4 SMART
low complexity region 276 287 N/A INTRINSIC
coiled coil region 345 368 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110560
SMART Domains Protein: ENSMUSP00000106189
Gene: ENSMUSG00000079076

DomainStartEndE-ValueType
Pfam:TIP49 1 58 3.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221921
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 93.9%
  • 20x: 83.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein with two WW domains, a SARAH domain, and a coiled-coil region and is ubiquitously expressed in adult tissues. This protein binds to MST1 (mammalian sterile 20-like kinase 1) and promotes MST1-induced apoptosis. It has also been shown to bind to HAX1 (hematopoietic cell-specific protein 1 (HS1)-associated protein X-1) and to attenuate the anti-apoptotic effects of HAX1. Studies in human and mouse suggest this gene acts as a tumor suppressor. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a null allele display fetal growth retardation and lethality, show multiple tissue hyperplasia and dysplasia due to unchecked proliferation and impaired terminal differentiation of epithelial cells, and develop hepatomas. Heterozygotes are prone to tumorigenesis and die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdh15 G C 8: 122,857,495 E112Q probably damaging Het
Clec7a T C 6: 129,465,525 I180V probably damaging Het
Csf3 A G 11: 98,702,477 D140G probably damaging Het
Cwf19l2 T C 9: 3,430,810 S381P probably benign Het
Eef1b2 A G 1: 63,177,273 D21G probably damaging Het
Fam83a A T 15: 57,995,248 Y228F possibly damaging Het
Gm5422 A G 10: 31,250,723 noncoding transcript Het
Itga5 A G 15: 103,357,473 V149A possibly damaging Het
Lrrfip1 A G 1: 91,115,193 H440R probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mindy4 T A 6: 55,284,813 L569H possibly damaging Het
Mme A G 3: 63,343,606 K356R probably benign Het
Nfkb1 A G 3: 135,594,927 I626T probably benign Het
Olfr1186 G C 2: 88,526,276 R231P possibly damaging Het
Olfr172 T C 16: 58,761,050 N42S probably damaging Het
Olfr38 T C 6: 42,762,667 V205A possibly damaging Het
Olfr720 T C 14: 14,176,029 T18A probably benign Het
Rock2 T A 12: 16,965,469 V789D probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r89 T C 14: 51,454,970 F77L probably benign Het
Vps50 G A 6: 3,594,884 V816I probably damaging Het
Other mutations in Sav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02305:Sav1 APN 12 69986776 utr 5 prime probably benign
R0512:Sav1 UTSW 12 69969201 nonsense probably null
R0883:Sav1 UTSW 12 69966205 missense probably benign
R1636:Sav1 UTSW 12 69984495 missense probably benign 0.01
R3159:Sav1 UTSW 12 69984552 missense probably benign 0.01
R4601:Sav1 UTSW 12 69984321 missense probably benign 0.00
R5738:Sav1 UTSW 12 69976043 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGATTAAAGATGTGCTGCCACC -3'
(R):5'- GGCTTGGATCTCAGTGATCTGCTTC -3'

Sequencing Primer
(F):5'- ATGTGCTGCCACCACCTAATC -3'
(R):5'- GGATCTCAGTGATCTGCTTCATCTC -3'
Posted On2014-01-15