Mutagenetix > Incidental Mutation

Incidental Mutation 'R1210:Sav1'

100660

Institutional Source

Beutler Lab

Gene Symbol

Sav1

Ensembl Gene

ENSMUSG00000021067

Gene Name

salvador family WW domain containing 1

Synonyms

1700040G09Rik, Salv, WW45

MMRRC Submission

039279-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1210 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70011786-70033776 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70015953 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 282 (Y282H)

Ref Sequence

ENSEMBL: ENSMUSP00000021467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021466] [ENSMUST00000021467]

AlphaFold

Q8VEB2

PDB Structure

Solution structure of the second WW domain from mouse salvador homolog 1 protein (mWW45) [SOLUTION NMR]
Solution structure of the first WW domain from the mouse salvador homolog 1 protein (SAV1) [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000021466

SMART Domains

Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:GBP	43	314	2.3e-103	PFAM
low complexity region	350	363	N/A	INTRINSIC
Blast:HAMP	468	519	9e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000021467
AA Change: Y282H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021467
Gene: ENSMUSG00000021067
AA Change: Y282H

Domain	Start	End	E-Value	Type
WW	201	233	1.63e-8	SMART
WW	236	268	4.98e-4	SMART
low complexity region	276	287	N/A	INTRINSIC
coiled coil region	345	368	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110560

SMART Domains

Protein: ENSMUSP00000106189
Gene: ENSMUSG00000079076

Domain	Start	End	E-Value	Type
Pfam:TIP49	1	58	3.1e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220735

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221248

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221921

Coding Region Coverage

1x: 99.1%
3x: 97.8%
10x: 93.9%
20x: 83.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein with two WW domains, a SARAH domain, and a coiled-coil region and is ubiquitously expressed in adult tissues. This protein binds to MST1 (mammalian sterile 20-like kinase 1) and promotes MST1-induced apoptosis. It has also been shown to bind to HAX1 (hematopoietic cell-specific protein 1 (HS1)-associated protein X-1) and to attenuate the anti-apoptotic effects of HAX1. Studies in human and mouse suggest this gene acts as a tumor suppressor. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a null allele display fetal growth retardation and lethality, show multiple tissue hyperplasia and dysplasia due to unchecked proliferation and impaired terminal differentiation of epithelial cells, and develop hepatomas. Heterozygotes are prone to tumorigenesis and die prematurely. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cdh15	G	C	8: 123,584,234 (GRCm39)	E112Q	probably damaging	Het
Clec7a	T	C	6: 129,442,488 (GRCm39)	I180V	probably damaging	Het
Csf3	A	G	11: 98,593,303 (GRCm39)	D140G	probably damaging	Het
Cwf19l2	T	C	9: 3,430,810 (GRCm39)	S381P	probably benign	Het
Eef1b2	A	G	1: 63,216,432 (GRCm39)	D21G	probably damaging	Het
Fam83a	A	T	15: 57,858,644 (GRCm39)	Y228F	possibly damaging	Het
Gm5422	A	G	10: 31,126,719 (GRCm39)		noncoding transcript	Het
Itga5	A	G	15: 103,265,900 (GRCm39)	V149A	possibly damaging	Het
Lrrfip1	A	G	1: 91,042,915 (GRCm39)	H440R	probably benign	Het
Mfsd13a	C	T	19: 46,354,943 (GRCm39)	T40I	probably benign	Het
Mindy4	T	A	6: 55,261,798 (GRCm39)	L569H	possibly damaging	Het
Mme	A	G	3: 63,251,027 (GRCm39)	K356R	probably benign	Het
Nfkb1	A	G	3: 135,300,688 (GRCm39)	I626T	probably benign	Het
Or2f1b	T	C	6: 42,739,601 (GRCm39)	V205A	possibly damaging	Het
Or2t6	T	C	14: 14,176,029 (GRCm38)	T18A	probably benign	Het
Or4c100	G	C	2: 88,356,620 (GRCm39)	R231P	possibly damaging	Het
Or5k1b	T	C	16: 58,581,413 (GRCm39)	N42S	probably damaging	Het
Rock2	T	A	12: 17,015,470 (GRCm39)	V789D	probably damaging	Het
Ugcg	C	T	4: 59,207,798 (GRCm39)	P46S	probably benign	Het
Vmn2r89	T	C	14: 51,692,427 (GRCm39)	F77L	probably benign	Het
Vps50	G	A	6: 3,594,884 (GRCm39)	V816I	probably damaging	Het

Other mutations in Sav1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02305:Sav1	APN	12	70,033,550 (GRCm39)	utr 5 prime	probably benign
R0512:Sav1	UTSW	12	70,015,975 (GRCm39)	nonsense	probably null
R0883:Sav1	UTSW	12	70,012,979 (GRCm39)	missense	probably benign
R1636:Sav1	UTSW	12	70,031,269 (GRCm39)	missense	probably benign	0.01
R3159:Sav1	UTSW	12	70,031,326 (GRCm39)	missense	probably benign	0.01
R4601:Sav1	UTSW	12	70,031,095 (GRCm39)	missense	probably benign	0.00
R5738:Sav1	UTSW	12	70,022,817 (GRCm39)	missense	possibly damaging	0.95
R7106:Sav1	UTSW	12	70,031,390 (GRCm39)	missense	probably damaging	0.99
R7788:Sav1	UTSW	12	70,030,995 (GRCm39)	missense	probably damaging	1.00
R7935:Sav1	UTSW	12	70,033,481 (GRCm39)	missense	probably damaging	1.00
R9178:Sav1	UTSW	12	70,022,790 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGGATTAAAGATGTGCTGCCACC -3'
(R):5'- GGCTTGGATCTCAGTGATCTGCTTC -3'

Sequencing Primer
(F):5'- ATGTGCTGCCACCACCTAATC -3'
(R):5'- GGATCTCAGTGATCTGCTTCATCTC -3'

Posted On

2014-01-15