Incidental Mutation 'R1268:Crebrf'
ID151227
Institutional Source Beutler Lab
Gene Symbol Crebrf
Ensembl Gene ENSMUSG00000048249
Gene NameCREB3 regulatory factor
SynonymsA930001N09Rik
MMRRC Submission 039335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.441) question?
Stock #R1268 (G1)
Quality Score127
Status Validated
Chromosome17
Chromosomal Location26715650-26776635 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTTTT to CTTT at 26739596 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062519] [ENSMUST00000142539] [ENSMUST00000144221] [ENSMUST00000151681]
Predicted Effect probably null
Transcript: ENSMUST00000062519
SMART Domains Protein: ENSMUSP00000059102
Gene: ENSMUSG00000048249

DomainStartEndE-ValueType
low complexity region 317 330 N/A INTRINSIC
low complexity region 356 407 N/A INTRINSIC
Blast:BRLZ 520 584 3e-35 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132972
Predicted Effect probably null
Transcript: ENSMUST00000142539
SMART Domains Protein: ENSMUSP00000114274
Gene: ENSMUSG00000048249

DomainStartEndE-ValueType
low complexity region 309 322 N/A INTRINSIC
low complexity region 348 399 N/A INTRINSIC
Blast:BRLZ 512 576 3e-35 BLAST
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000144221
SMART Domains Protein: ENSMUSP00000120212
Gene: ENSMUSG00000048249

DomainStartEndE-ValueType
low complexity region 317 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151681
SMART Domains Protein: ENSMUSP00000119186
Gene: ENSMUSG00000048249

DomainStartEndE-ValueType
Blast:BRLZ 100 137 2e-18 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired social recognition, increased vertical and horizontal activity, abnormal maternal nurturing, decreased prolactin and corticosterone serum levels, and abnormal mammary gland growth during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T C 17: 13,887,986 V1257A probably damaging Het
Aplnr A G 2: 85,137,431 T267A possibly damaging Het
Arap2 A G 5: 62,730,621 S461P probably benign Het
Brpf3 A G 17: 28,836,556 T1160A probably damaging Het
Col5a1 A T 2: 28,002,489 T1005S unknown Het
Fmo6 A T 1: 162,920,517 I326N probably damaging Het
Foxp4 G C 17: 47,880,353 probably benign Het
Gnat1 A G 9: 107,675,877 probably benign Het
Hs6st1 T A 1: 36,068,926 V90D probably damaging Het
Igsf11 A G 16: 39,024,854 T257A probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Mab21l3 C T 3: 101,835,047 E66K possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mybl2 A G 2: 163,074,716 N429S probably benign Het
Mycbp2 G A 14: 103,208,782 T1837I probably damaging Het
Myh7b C A 2: 155,614,046 S117* probably null Het
Nek1 C A 8: 61,022,264 A202E probably damaging Het
Notum C T 11: 120,658,667 W159* probably null Het
Ntn1 TCCTCGGC TC 11: 68,213,133 probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1308 G T 2: 111,960,877 N65K possibly damaging Het
Olfr1364 C T 13: 21,574,328 V43M probably benign Het
Olfr1451 T C 19: 12,999,261 Y92H possibly damaging Het
Olfr48 A G 2: 89,844,154 I273T probably damaging Het
Olfr494 A T 7: 108,367,795 I102F probably benign Het
Olfr834 T C 9: 18,988,356 F123L probably damaging Het
Plk4 T A 3: 40,811,369 V659D probably damaging Het
Rbm27 T C 18: 42,333,302 S866P probably damaging Het
Rnaseh2b A T 14: 62,372,455 K303N possibly damaging Het
Samd9l C T 6: 3,376,113 V383I possibly damaging Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slc35f2 T A 9: 53,797,913 Y62* probably null Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Ulk1 A G 5: 110,790,277 S610P probably damaging Het
Ulk4 C A 9: 121,257,074 probably benign Het
Vdr T C 15: 97,857,475 N389S probably benign Het
Other mutations in Crebrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Crebrf APN 17 26743093 missense probably damaging 1.00
IGL03106:Crebrf APN 17 26771319 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0046:Crebrf UTSW 17 26763334 missense probably damaging 1.00
R0254:Crebrf UTSW 17 26739594 missense probably benign 0.01
R0448:Crebrf UTSW 17 26743102 missense probably benign 0.42
R1857:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1858:Crebrf UTSW 17 26742963 missense probably benign 0.00
R1937:Crebrf UTSW 17 26742468 missense probably damaging 1.00
R2005:Crebrf UTSW 17 26742883 missense possibly damaging 0.53
R2006:Crebrf UTSW 17 26742883 missense possibly damaging 0.53
R2031:Crebrf UTSW 17 26742921 missense probably damaging 0.97
R2323:Crebrf UTSW 17 26763607 unclassified probably benign
R2352:Crebrf UTSW 17 26742346 missense probably damaging 1.00
R4510:Crebrf UTSW 17 26742964 missense probably benign
R4511:Crebrf UTSW 17 26742964 missense probably benign
R4585:Crebrf UTSW 17 26762255 missense probably damaging 1.00
R4642:Crebrf UTSW 17 26743061 missense probably benign 0.23
R4896:Crebrf UTSW 17 26742420 missense possibly damaging 0.75
R5227:Crebrf UTSW 17 26759765 missense probably damaging 1.00
R5377:Crebrf UTSW 17 26759865 missense probably damaging 0.99
R5443:Crebrf UTSW 17 26742354 missense probably damaging 1.00
R5540:Crebrf UTSW 17 26742097 missense possibly damaging 0.90
R6017:Crebrf UTSW 17 26757849 missense probably benign 0.04
R6132:Crebrf UTSW 17 26763403 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGCTGACTCTAGTGCCCCAAACC -3'
(R):5'- TTAAAACCAGACCTGTGTGGCCCC -3'

Sequencing Primer
(F):5'- tcattctctctctctttctttctttc -3'
(R):5'- CCAGCTCATACATGAAATCTGG -3'
Posted On2014-01-29