Incidental Mutation 'R1244:Ppp4c'
ID152088
Institutional Source Beutler Lab
Gene Symbol Ppp4c
Ensembl Gene ENSMUSG00000030697
Gene Nameprotein phosphatase 4, catalytic subunit
Synonyms1110002D08Rik, PPX
MMRRC Submission 039311-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1244 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126785866-126792496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126786280 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 119 (V119A)
Ref Sequence ENSEMBL: ENSMUSP00000146202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032936] [ENSMUST00000094037] [ENSMUST00000172352] [ENSMUST00000205786] [ENSMUST00000205935] [ENSMUST00000206353] [ENSMUST00000206570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032936
AA Change: V269A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697
AA Change: V269A

DomainStartEndE-ValueType
PP2Ac 20 290 4.04e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094037
SMART Domains Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 332 348 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172352
SMART Domains Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 333 349 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205786
AA Change: V119A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205879
Predicted Effect probably benign
Transcript: ENSMUST00000205935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206261
Predicted Effect probably benign
Transcript: ENSMUST00000206334
Predicted Effect probably benign
Transcript: ENSMUST00000206353
Predicted Effect probably benign
Transcript: ENSMUST00000206477
Predicted Effect possibly damaging
Transcript: ENSMUST00000206570
AA Change: V269A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryonic Ppp4c-deficiency leads to early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C T 12: 71,216,144 T1417I probably benign Het
Abca14 G A 7: 120,216,338 A270T probably benign Het
Ash2l T C 8: 25,817,421 S529G probably damaging Het
Atp13a3 T C 16: 30,361,836 Y125C probably benign Het
Btbd11 C A 10: 85,387,363 T12K unknown Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cct4 A G 11: 22,996,417 E131G probably benign Het
Cd84 A G 1: 171,851,830 D25G probably damaging Het
Chd9 A G 8: 91,022,929 D1728G probably damaging Het
Cyp39a1 A T 17: 43,749,945 K461N probably benign Het
Ddx50 T A 10: 62,642,924 Q161L probably damaging Het
Golga5 A G 12: 102,472,295 T90A probably benign Het
Heatr3 A G 8: 88,141,739 E39G possibly damaging Het
Hipk3 G A 2: 104,433,256 R905W probably damaging Het
Hsd11b1 T G 1: 193,223,760 M175L probably benign Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il10 A G 1: 131,024,216 D162G probably damaging Het
Mapre2 A G 18: 23,853,717 K62R probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Ogfod1 A G 8: 94,037,371 D28G probably benign Het
Olfr1436 A T 19: 12,298,496 I212N probably damaging Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Scn2a T C 2: 65,763,655 I1616T probably damaging Het
Sipa1l1 A G 12: 82,425,416 N1390S probably benign Het
Sub1 A T 15: 11,991,044 V37E possibly damaging Het
Tbc1d17 A T 7: 44,844,398 V267E probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r77 A T 7: 12,041,920 T140S possibly damaging Het
Vmn2r15 A T 5: 109,293,226 Y255* probably null Het
Other mutations in Ppp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0030:Ppp4c UTSW 7 126788433 missense possibly damaging 0.93
R0601:Ppp4c UTSW 7 126787288 missense probably benign 0.01
R0602:Ppp4c UTSW 7 126789082 splice site probably benign
R1187:Ppp4c UTSW 7 126786200 missense probably benign 0.02
R1346:Ppp4c UTSW 7 126792050 splice site probably benign
R1878:Ppp4c UTSW 7 126787607 missense probably damaging 1.00
R1892:Ppp4c UTSW 7 126786280 missense probably damaging 0.96
R2072:Ppp4c UTSW 7 126787348 critical splice acceptor site probably null
R2313:Ppp4c UTSW 7 126787457 missense probably damaging 0.99
R2863:Ppp4c UTSW 7 126792100 missense probably damaging 0.98
R2865:Ppp4c UTSW 7 126792100 missense probably damaging 0.98
R3808:Ppp4c UTSW 7 126787327 missense probably damaging 1.00
R3809:Ppp4c UTSW 7 126787327 missense probably damaging 1.00
R4290:Ppp4c UTSW 7 126792059 critical splice donor site probably null
R4504:Ppp4c UTSW 7 126787465 missense probably damaging 1.00
R5001:Ppp4c UTSW 7 126787537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCAGAGCAGGTCTCCATGTC -3'
(R):5'- CGTGCCCACCAATTAGTGATGGAAG -3'

Sequencing Primer
(F):5'- TCTCCAGAGCAAGTCCGC -3'
(R):5'- AGGCTACAAGTGGCACTTC -3'
Posted On2014-01-29