Incidental Mutation 'R1329:Acot7'
ID156110
Institutional Source Beutler Lab
Gene Symbol Acot7
Ensembl Gene ENSMUSG00000028937
Gene Nameacyl-CoA thioesterase 7
Synonyms2410041A17Rik, Bach, AU014716
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R1329 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152178134-152271855 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 152229784 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 188 (Q188*)
Ref Sequence ENSEMBL: ENSMUSP00000129121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030779] [ENSMUST00000075363] [ENSMUST00000105652] [ENSMUST00000167926]
Predicted Effect probably null
Transcript: ENSMUST00000030779
AA Change: Q185*
SMART Domains Protein: ENSMUSP00000030779
Gene: ENSMUSG00000028937
AA Change: Q185*

DomainStartEndE-ValueType
Pfam:4HBT 69 152 1e-16 PFAM
Pfam:4HBT 243 318 4.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075363
AA Change: Q183*
SMART Domains Protein: ENSMUSP00000074827
Gene: ENSMUSG00000028937
AA Change: Q183*

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 30 36 N/A INTRINSIC
Pfam:4HBT 67 150 1.2e-16 PFAM
Pfam:4HBT 241 316 5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105652
AA Change: Q154*
SMART Domains Protein: ENSMUSP00000101277
Gene: ENSMUSG00000028937
AA Change: Q154*

DomainStartEndE-ValueType
Pfam:4HBT 38 121 1.1e-16 PFAM
Pfam:4HBT 212 287 4.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167926
AA Change: Q188*
SMART Domains Protein: ENSMUSP00000129121
Gene: ENSMUSG00000028937
AA Change: Q188*

DomainStartEndE-ValueType
Pfam:4HBT 72 155 2.3e-17 PFAM
Pfam:4HBT 246 320 1.2e-19 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl coenzyme family. The encoded protein hydrolyzes the CoA thioester of palmitoyl-CoA and other long-chain fatty acids. Decreased expression of this gene may be associated with mesial temporal lobe epilepsy. Alternatively spliced transcript variants encoding distinct isoforms with different subcellular locations have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed allele activated in neurons exhibit abnormal glucose and lipid homeostasis, altered metabolism, increaased adiposity, decreased lean mass, progressive neurodegeneration, and neurological defects in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik T A 11: 29,823,553 N635Y probably benign Het
Ano5 T C 7: 51,546,785 Y141H probably benign Het
Atg101 G A 15: 101,290,290 G92D probably null Het
Brwd1 A G 16: 96,003,234 I1912T probably benign Het
C530008M17Rik A G 5: 76,657,932 probably benign Het
Cad G T 5: 31,059,582 G263W probably damaging Het
Clstn2 T C 9: 97,458,174 E715G probably damaging Het
Dbp C T 7: 45,708,328 P70S probably damaging Het
Gpr61 T A 3: 108,150,514 H277L probably benign Het
Gsdma3 G T 11: 98,632,392 V203F probably damaging Het
Ifih1 G C 2: 62,617,487 probably null Het
Myo1e T A 9: 70,338,738 C404S possibly damaging Het
Myrfl A G 10: 116,777,342 probably null Het
Nfat5 T G 8: 107,369,027 M1300R probably benign Het
Nfrkb C T 9: 31,414,647 P1129S possibly damaging Het
Nubp2 A T 17: 24,883,864 N208K possibly damaging Het
Olfr44 A G 9: 39,484,444 S270P probably damaging Het
Ovch2 T C 7: 107,785,446 D488G probably damaging Het
Rfx6 A T 10: 51,693,737 Y202F probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Usp4 T A 9: 108,372,566 V431E probably damaging Het
Vil1 A G 1: 74,427,558 I636V probably benign Het
Vmn2r116 A G 17: 23,387,188 N358S possibly damaging Het
Wdr47 T A 3: 108,627,299 N511K probably benign Het
Wdr5 T A 2: 27,531,671 F222I probably damaging Het
Other mutations in Acot7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Acot7 APN 4 152260896 missense probably benign 0.39
IGL01758:Acot7 APN 4 152217793 missense probably damaging 0.96
IGL01991:Acot7 APN 4 152223079 missense possibly damaging 0.84
R1605:Acot7 UTSW 4 152206828 missense possibly damaging 0.46
R1625:Acot7 UTSW 4 152186291 missense probably benign 0.01
R1739:Acot7 UTSW 4 152260912 missense probably damaging 1.00
R4169:Acot7 UTSW 4 152217793 missense probably damaging 0.96
R4473:Acot7 UTSW 4 152206856 missense probably damaging 1.00
R4857:Acot7 UTSW 4 152237754 missense possibly damaging 0.76
R4884:Acot7 UTSW 4 152186207 intron probably benign
R5000:Acot7 UTSW 4 152186363 missense probably benign 0.00
R6123:Acot7 UTSW 4 152199945 missense probably benign
R6633:Acot7 UTSW 4 152178259 missense probably benign
R6938:Acot7 UTSW 4 152217894 critical splice donor site probably null
R7025:Acot7 UTSW 4 152178189 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGGTCTGTCCATCCATCTGTCC -3'
(R):5'- CTGTGCTAAGAAAGAGGTCTGCCTG -3'

Sequencing Primer
(F):5'- GGCACCCCCTGAAAGTTTG -3'
(R):5'- AAAGAGGTCTGCCTGGCTTAG -3'
Posted On2014-02-11