Incidental Mutation 'R1348:Abca3'
ID156582
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene NameATP-binding cassette, sub-family A (ABC1), member 3
SynonymsABC-C, 1810036E22Rik, Abc3
MMRRC Submission 039413-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1348 (G1)
Quality Score149
Status Not validated
Chromosome17
Chromosomal Location24351950-24410201 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 24374238 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
Predicted Effect probably null
Transcript: ENSMUST00000039013
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000079594
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117337
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149233
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 87.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art1 G A 7: 102,107,372 A33T possibly damaging Het
Aspa G A 11: 73,324,483 T2I probably damaging Het
Cntn1 C T 15: 92,314,663 T902I probably damaging Het
Dpep1 G A 8: 123,199,160 C118Y probably benign Het
Fam35a T A 14: 34,268,923 I9F probably damaging Het
Fam71f2 A G 6: 29,283,285 H36R probably benign Het
Gucy2g C T 19: 55,222,906 V631I possibly damaging Het
Igf1r C G 7: 68,218,468 N1220K probably damaging Het
Insr A T 8: 3,192,635 I28N probably damaging Het
Katnal2 T C 18: 76,978,542 probably null Het
Klrb1a T C 6: 128,609,834 D156G possibly damaging Het
Kpna6 G A 4: 129,661,359 R26* probably null Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Naa15 C G 3: 51,465,670 C661W probably damaging Het
Olfr20 G T 11: 73,353,856 M34I probably benign Het
Olfr44 A G 9: 39,485,236 S3P probably benign Het
Olfr978 T C 9: 39,993,828 I6T probably benign Het
Paxbp1 A G 16: 91,035,016 V328A probably damaging Het
Pkd1l1 T C 11: 8,834,806 T1993A probably benign Het
Pold1 C T 7: 44,534,682 V865I probably benign Het
Racgap1 A G 15: 99,626,365 I387T possibly damaging Het
Rbm15 G T 3: 107,332,630 R151S possibly damaging Het
Rbms2 C T 10: 128,176,345 probably null Het
Recql4 A G 15: 76,709,211 I140T probably benign Het
Sorl1 A T 9: 42,000,412 probably null Het
Speg G A 1: 75,422,872 G2321D probably damaging Het
Trp53tg5 A G 2: 164,473,601 probably null Het
Tyw3 A C 3: 154,593,814 M86R possibly damaging Het
Vmn1r11 G A 6: 57,137,978 C209Y probably benign Het
Zfp472 T A 17: 32,977,820 F290I probably benign Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24374246 missense probably damaging 1.00
IGL01538:Abca3 APN 17 24376473 missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24397353 nonsense probably null
IGL01837:Abca3 APN 17 24408697 missense probably damaging 1.00
IGL01986:Abca3 APN 17 24408114 missense probably damaging 1.00
IGL02049:Abca3 APN 17 24376730 nonsense probably null
IGL02186:Abca3 APN 17 24377740 missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24402411 missense probably benign 0.05
IGL02962:Abca3 APN 17 24400409 missense probably damaging 1.00
IGL02963:Abca3 APN 17 24384529 missense probably damaging 1.00
IGL03118:Abca3 APN 17 24400450 missense probably benign 0.17
IGL03144:Abca3 APN 17 24381964 missense probably benign 0.37
R0028:Abca3 UTSW 17 24377724 missense probably benign 0.39
R0278:Abca3 UTSW 17 24381920 missense probably benign 0.09
R0570:Abca3 UTSW 17 24374399 missense probably benign
R0825:Abca3 UTSW 17 24400577 missense probably damaging 1.00
R1164:Abca3 UTSW 17 24402331 missense probably damaging 1.00
R1557:Abca3 UTSW 17 24399980 missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1665:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1754:Abca3 UTSW 17 24377779 missense probably benign 0.00
R1828:Abca3 UTSW 17 24366197 missense probably benign 0.34
R1834:Abca3 UTSW 17 24376692 missense probably benign 0.00
R1996:Abca3 UTSW 17 24387532 missense probably damaging 1.00
R2032:Abca3 UTSW 17 24366082 splice site probably benign
R2100:Abca3 UTSW 17 24408209 missense probably damaging 0.99
R2154:Abca3 UTSW 17 24377719 missense probably damaging 1.00
R2240:Abca3 UTSW 17 24376443 missense probably damaging 0.98
R2281:Abca3 UTSW 17 24376726 missense possibly damaging 0.88
R2994:Abca3 UTSW 17 24384564 missense probably damaging 1.00
R4091:Abca3 UTSW 17 24397482 missense probably damaging 1.00
R4294:Abca3 UTSW 17 24400569 missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24383973 missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24387529 missense probably null 1.00
R4866:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5022:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5023:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5072:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5073:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5074:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5123:Abca3 UTSW 17 24384460 missense possibly damaging 0.95
R5157:Abca3 UTSW 17 24408122 missense probably damaging 1.00
R5183:Abca3 UTSW 17 24374453 missense probably benign 0.39
R5269:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24383927 missense probably benign
R5579:Abca3 UTSW 17 24376729 missense probably damaging 0.97
R5620:Abca3 UTSW 17 24396470 missense probably benign 0.05
R5755:Abca3 UTSW 17 24398454 missense probably damaging 1.00
R5954:Abca3 UTSW 17 24397416 missense probably benign 0.00
R6041:Abca3 UTSW 17 24376380 missense probably damaging 0.99
R6187:Abca3 UTSW 17 24408167 missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24397552 missense probably benign 0.01
R6375:Abca3 UTSW 17 24387562 missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24397472 missense possibly damaging 0.81
R6616:Abca3 UTSW 17 24384535 missense probably damaging 1.00
R6632:Abca3 UTSW 17 24384470 missense probably benign
R6781:Abca3 UTSW 17 24374406 missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24408658 missense probably damaging 1.00
R6962:Abca3 UTSW 17 24364726 missense probably benign 0.39
R7163:Abca3 UTSW 17 24364942 missense probably benign
R7199:Abca3 UTSW 17 24377707 missense probably damaging 1.00
R7287:Abca3 UTSW 17 24385887 missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24398521 missense possibly damaging 0.83
X0018:Abca3 UTSW 17 24396480 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGTGACCACTGAATGTTGTCAGATGC -3'
(R):5'- AGACTGACTTGCCATGCACAGAG -3'

Sequencing Primer
(F):5'- CACTGAATGTTGTCAGATGCTATTAG -3'
(R):5'- CATGCACAGAGGGTTACCTTTAG -3'
Posted On2014-02-11