Incidental Mutation 'R1371:Hsh2d'
ID157317
Institutional Source Beutler Lab
Gene Symbol Hsh2d
Ensembl Gene ENSMUSG00000062007
Gene Namehematopoietic SH2 domain containing
SynonymsALX, Hsh2
MMRRC Submission 039435-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R1371 (G1)
Quality Score145
Status Validated
Chromosome8
Chromosomal Location72189638-72201527 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 72196894 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000165324]
Predicted Effect probably benign
Transcript: ENSMUST00000072097
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165324
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.7%
  • 20x: 89.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced IL-2 production, increased T cell proliferation in response to TCR/CD28 stimulation, splenomegaly, and an increased frequency of activated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,953,553 D884V probably damaging Het
Acvr2a C T 2: 48,899,616 T457M probably damaging Het
Akr1b10 C T 6: 34,392,459 T208I probably benign Het
Aldh16a1 G T 7: 45,147,250 T275K possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Asgr1 T G 11: 70,056,097 C56W probably benign Het
Atp11b T C 3: 35,806,769 I335T probably damaging Het
BC061237 A G 14: 44,504,305 probably benign Het
Bdh1 G T 16: 31,456,902 K280N probably benign Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Ccdc181 A G 1: 164,280,603 E285G probably benign Het
Ces1f C T 8: 93,279,649 G18R probably damaging Het
Cfap43 T A 19: 47,835,606 I109L possibly damaging Het
Cma2 T C 14: 55,972,826 L56S probably damaging Het
Edc4 A G 8: 105,890,750 probably benign Het
F3 T C 3: 121,732,510 C241R probably damaging Het
Fhdc1 T A 3: 84,445,003 S972C probably damaging Het
H2afy2 A T 10: 61,749,333 D177E possibly damaging Het
Heatr1 T G 13: 12,417,632 I1086R possibly damaging Het
Ice1 T C 13: 70,596,221 Y2081C probably damaging Het
Il1rl1 A G 1: 40,442,713 N194D probably damaging Het
Ip6k1 G A 9: 108,045,823 V385M probably damaging Het
Lig1 G A 7: 13,288,685 R147Q probably damaging Het
Lrp1b C T 2: 40,647,153 V41I probably damaging Het
Mst1r T A 9: 107,917,225 V1201E probably damaging Het
Myof T C 19: 37,903,668 probably benign Het
Nbas G T 12: 13,482,378 probably benign Het
Ndst1 A G 18: 60,707,647 I321T possibly damaging Het
Nek10 G A 14: 14,850,983 G343R probably damaging Het
Olfr13 A T 6: 43,174,300 T105S probably benign Het
Olfr1385 T A 11: 49,494,823 C97S probably damaging Het
Olfr462 A T 11: 87,889,296 I200N probably damaging Het
Pde4d T C 13: 109,117,061 S141P probably benign Het
Pigm A T 1: 172,376,814 Q39L probably damaging Het
Prl7a2 T A 13: 27,662,767 I88F probably benign Het
Prss16 T A 13: 22,008,686 probably benign Het
Psmc4 G A 7: 28,042,797 probably benign Het
Ptger3 T A 3: 157,567,728 C237* probably null Het
Recql G A 6: 142,372,875 T214M probably damaging Het
Rfx7 T A 9: 72,619,575 V1349D probably damaging Het
Ros1 A G 10: 52,087,945 S1740P probably damaging Het
Rrm2b A T 15: 37,946,809 S83T probably benign Het
Sall4 A G 2: 168,756,474 Y149H probably benign Het
Smad1 A G 8: 79,349,578 probably benign Het
Snrnp70 T C 7: 45,380,705 probably benign Het
Spef2 C A 15: 9,725,108 probably benign Het
Sptlc1 T C 13: 53,351,624 T253A probably benign Het
Zbbx T C 3: 75,052,477 Y595C possibly damaging Het
Zfp382 T C 7: 30,133,689 V255A probably benign Het
Other mutations in Hsh2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Hsh2d APN 8 72200619 missense probably damaging 0.98
IGL01134:Hsh2d APN 8 72193531 missense probably damaging 0.96
IGL01778:Hsh2d APN 8 72193507 missense probably damaging 1.00
IGL03324:Hsh2d APN 8 72193512 missense probably damaging 1.00
R0002:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0064:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0309:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0312:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0369:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0449:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0450:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0481:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0483:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0554:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0704:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0843:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0947:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0948:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0966:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R0967:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1051:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1055:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1076:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1105:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1108:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1144:Hsh2d UTSW 8 72193592 splice site probably benign
R1150:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1186:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1345:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1400:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1419:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1430:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1514:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1551:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1691:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1857:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1859:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R1914:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1915:Hsh2d UTSW 8 72193521 missense probably damaging 1.00
R1982:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2050:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2081:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R2105:Hsh2d UTSW 8 72200646 missense probably benign
R4077:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4078:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4823:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4824:Hsh2d UTSW 8 72200460 missense probably benign 0.01
R4903:Hsh2d UTSW 8 72193528 missense probably benign
R4966:Hsh2d UTSW 8 72193528 missense probably benign
R6550:Hsh2d UTSW 8 72198453 missense probably benign
R7418:Hsh2d UTSW 8 72196794 critical splice acceptor site probably null
Y4335:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4336:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4337:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Y4338:Hsh2d UTSW 8 72200460 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTGCTTGCCCCATATCCAGCCAG -3'
(R):5'- AAGACGGAGGAGGGCTTTACCTTG -3'

Sequencing Primer
(F):5'- CCCATATCCAGCCAGTCTTC -3'
(R):5'- GACCCAGACTCATGTCACTAATTTG -3'
Posted On2014-02-18