Incidental Mutation 'R1444:Card10'
ID158733
Institutional Source Beutler Lab
Gene Symbol Card10
Ensembl Gene ENSMUSG00000033170
Gene Namecaspase recruitment domain family, member 10
SynonymsBimp1, CARMA3
MMRRC Submission 039499-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1444 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78775138-78803042 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 78787841 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164826] [ENSMUST00000170584]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000071115
Predicted Effect probably benign
Transcript: ENSMUST00000164826
SMART Domains Protein: ENSMUSP00000129513
Gene: ENSMUSG00000033170

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
Pfam:CARD 77 163 1.1e-22 PFAM
coiled coil region 188 498 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
low complexity region 607 614 N/A INTRINSIC
low complexity region 692 706 N/A INTRINSIC
PDB:3SHW|A 744 1055 1e-7 PDB
Blast:SH3 747 812 8e-8 BLAST
Blast:GuKc 883 1045 1e-19 BLAST
low complexity region 1057 1068 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170584
SMART Domains Protein: ENSMUSP00000131003
Gene: ENSMUSG00000033170

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:CARD 28 114 5.6e-23 PFAM
coiled coil region 139 449 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
low complexity region 558 565 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
PDB:3SHW|A 695 1006 1e-7 PDB
Blast:SH3 698 763 7e-8 BLAST
Blast:GuKc 834 996 1e-19 BLAST
low complexity region 1008 1019 N/A INTRINSIC
Meta Mutation Damage Score 0.0904 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.1%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The caspase recruitment domain (CARD) is a protein module that consists of 6 or 7 antiparallel alpha helices. It participates in apoptosis signaling through highly specific protein-protein homophilic interactions. Like several other CARD proteins, CARD10 belongs to the membrane-associated guanylate kinase (MAGUK) family and activates NF-kappa-B (NFKB; see MIM 164011) through BCL10 (MIM 603517) (Wang et al., 2001 [PubMed 11259443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit partial penetrance of anencephaly and subsequent perinatal lethality of anencephalic embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 72,451,386 D347V probably damaging Het
4932431P20Rik T C 7: 29,529,955 noncoding transcript Het
A630010A05Rik T A 16: 14,609,694 F82I possibly damaging Het
Acad9 T A 3: 36,078,508 F297L possibly damaging Het
Adgrl3 A T 5: 81,512,353 Y323F probably damaging Het
Brca2 T A 5: 150,542,450 M1893K probably benign Het
Cactin A T 10: 81,322,436 probably null Het
Cadm4 A G 7: 24,503,621 *389W probably null Het
Calr4 A G 4: 109,246,241 T183A possibly damaging Het
Cdh6 C A 15: 13,091,838 G14C probably benign Het
Cds1 A G 5: 101,798,379 Y148C probably damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Cr1l A T 1: 195,131,202 L35Q probably damaging Het
Daam2 T C 17: 49,480,751 R445G possibly damaging Het
Ddn G A 15: 98,806,604 T269M probably damaging Het
Epb41 G A 4: 132,006,071 S176L probably benign Het
Ephx2 T C 14: 66,107,320 D167G probably damaging Het
Erbb4 G A 1: 68,254,600 R711C probably damaging Het
Flg2 T A 3: 93,202,313 H549Q unknown Het
Gje1 A G 10: 14,716,636 probably null Het
Heatr5b G A 17: 78,753,193 H2018Y probably benign Het
Heatr5b A T 17: 78,755,427 probably benign Het
Hectd3 G T 4: 116,996,396 R189L probably benign Het
Hsd3b6 T C 3: 98,807,921 T52A probably benign Het
Il10rb T G 16: 91,421,787 probably null Het
Kcnc2 T C 10: 112,455,601 probably benign Het
Lpl T A 8: 68,892,747 D134E probably damaging Het
Lrit1 T C 14: 37,061,971 F419L probably benign Het
Mmp8 T C 9: 7,567,263 C422R probably benign Het
Myo18b A G 5: 112,775,251 probably null Het
Ncor1 T A 11: 62,403,806 I280F probably damaging Het
Obox2 A C 7: 15,397,032 Q63P possibly damaging Het
Olfr1368 C T 13: 21,142,167 V297I probably benign Het
Olfr462 T A 11: 87,889,759 I46L probably benign Het
Phldb2 T A 16: 45,757,253 probably benign Het
Pkd1l1 A G 11: 8,854,386 F1735S probably damaging Het
Pramef6 G T 4: 143,896,891 L238I probably benign Het
Prss30 T C 17: 23,973,738 Y156C probably damaging Het
Rnf213 T C 11: 119,442,400 S2812P probably damaging Het
Rttn A G 18: 89,042,867 D1053G probably benign Het
Slc6a2 A G 8: 92,971,254 N120S probably damaging Het
Snrnp200 T C 2: 127,228,238 probably benign Het
Spindoc G T 19: 7,382,721 D27E probably benign Het
Svep1 T C 4: 58,115,754 T980A possibly damaging Het
Tgfbr1 A G 4: 47,393,259 E46G probably benign Het
Tmem183a T C 1: 134,361,546 I49V probably benign Het
Tmem212 C T 3: 27,885,095 V81I possibly damaging Het
Toporsl T A 4: 52,610,254 I49N probably benign Het
Trim67 A G 8: 124,823,193 T521A probably benign Het
Vsnl1 T C 12: 11,332,218 probably null Het
Xrn2 C T 2: 147,061,488 R803W probably damaging Het
Zfp131 A T 13: 119,790,248 C9S probably damaging Het
Zfp750 C T 11: 121,512,047 S625N probably damaging Het
Zfp871 G T 17: 32,774,926 T406N possibly damaging Het
Other mutations in Card10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Card10 APN 15 78778215 missense probably damaging 1.00
IGL02804:Card10 APN 15 78802449 missense probably damaging 1.00
PIT4366001:Card10 UTSW 15 78787431 missense probably benign 0.14
R0529:Card10 UTSW 15 78780475 critical splice donor site probably null
R0571:Card10 UTSW 15 78787401 missense possibly damaging 0.88
R1118:Card10 UTSW 15 78802443 missense possibly damaging 0.90
R1632:Card10 UTSW 15 78791220 nonsense probably null
R1669:Card10 UTSW 15 78793953 missense probably benign 0.20
R1862:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1863:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1997:Card10 UTSW 15 78793975 missense probably damaging 0.99
R2046:Card10 UTSW 15 78787473 missense possibly damaging 0.91
R2084:Card10 UTSW 15 78792971 missense possibly damaging 0.81
R2509:Card10 UTSW 15 78780273 missense probably benign 0.00
R2511:Card10 UTSW 15 78780273 missense probably benign 0.00
R4274:Card10 UTSW 15 78780514 missense probably damaging 1.00
R4887:Card10 UTSW 15 78781524 missense possibly damaging 0.66
R4970:Card10 UTSW 15 78802380 critical splice donor site probably null
R5098:Card10 UTSW 15 78776717 missense probably benign 0.37
R5112:Card10 UTSW 15 78802380 critical splice donor site probably null
R5243:Card10 UTSW 15 78780672 missense possibly damaging 0.70
R5256:Card10 UTSW 15 78778251 missense probably damaging 0.98
R5985:Card10 UTSW 15 78791211 missense probably benign 0.01
R6089:Card10 UTSW 15 78802414 missense probably benign 0.02
R6357:Card10 UTSW 15 78799379 missense probably damaging 1.00
R6545:Card10 UTSW 15 78776810 missense probably damaging 1.00
R6865:Card10 UTSW 15 78802622 missense possibly damaging 0.70
R6907:Card10 UTSW 15 78787471 missense possibly damaging 0.82
R6920:Card10 UTSW 15 78802409 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAGTCTCCCATACAGCTTCCAGG -3'
(R):5'- TTCCATGTGCAGGGTACGCAAG -3'

Sequencing Primer
(F):5'- CAAGGAACTCCCCAAAGTGA -3'
(R):5'- TGAAGTGACTTGCACTCACAG -3'
Posted On2014-03-14