Incidental Mutation 'R1383:Ptpn6'
ID163131
Institutional Source Beutler Lab
Gene Symbol Ptpn6
Ensembl Gene ENSMUSG00000004266
Gene Nameprotein tyrosine phosphatase, non-receptor type 6
SynonymsHcph, hcp, SHP-1, Ptp1C
MMRRC Submission 039445-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R1383 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124720707-124738714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124721893 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 486 (I486T)
Ref Sequence ENSEMBL: ENSMUSP00000129124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004377] [ENSMUST00000112484] [ENSMUST00000171549] [ENSMUST00000174265]
Predicted Effect probably damaging
Transcript: ENSMUST00000004377
AA Change: I486T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266
AA Change: I486T

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083540
Predicted Effect probably damaging
Transcript: ENSMUST00000112484
AA Change: I484T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: I484T

DomainStartEndE-ValueType
SH2 2 85 4.05e-28 SMART
SH2 108 200 1.45e-29 SMART
PTPc 243 517 7.51e-131 SMART
low complexity region 569 579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145447
Predicted Effect probably damaging
Transcript: ENSMUST00000171549
AA Change: I486T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266
AA Change: I486T

DomainStartEndE-ValueType
SH2 4 87 1.43e-28 SMART
SH2 110 202 1.45e-29 SMART
PTPc 245 519 7.51e-131 SMART
low complexity region 571 581 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174265
AA Change: I445T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266
AA Change: I445T

DomainStartEndE-ValueType
Pfam:SH2 1 40 3.5e-6 PFAM
SH2 69 161 1.45e-29 SMART
PTPc 204 478 7.51e-131 SMART
low complexity region 530 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189387
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis.
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asph T A 4: 9,537,807 probably null Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eef1akmt1 A G 14: 57,558,032 probably null Het
Ext2 T C 2: 93,806,113 T219A possibly damaging Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Fat2 G A 11: 55,310,773 H492Y probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Kcmf1 A G 6: 72,849,582 F155L possibly damaging Het
Miox G A 15: 89,335,042 R38Q probably damaging Het
Mmrn1 A G 6: 60,976,322 Y529C probably damaging Het
Msmo1 G A 8: 64,723,645 T116I probably benign Het
Olfr1090 C T 2: 86,754,494 M81I possibly damaging Het
Olfr1107 A G 2: 87,071,792 L114P probably damaging Het
Olfr1259 A T 2: 89,943,551 M188K probably benign Het
Olfr229 A T 9: 39,909,864 K20N probably benign Het
Slc12a8 T C 16: 33,534,987 F58L probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snrnp200 T C 2: 127,218,411 I525T probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Znrf3 G C 11: 5,281,994 F410L probably damaging Het
Other mutations in Ptpn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ptpn6 APN 6 124732356 missense probably null
IGL01490:Ptpn6 APN 6 124728344 missense probably damaging 1.00
IGL01865:Ptpn6 APN 6 124732465 missense probably damaging 1.00
IGL02017:Ptpn6 APN 6 124732486 missense probably benign 0.00
IGL02272:Ptpn6 APN 6 124721208 missense probably damaging 0.99
IGL02276:Ptpn6 APN 6 124728865 missense probably null 1.00
IGL02556:Ptpn6 APN 6 124728660 missense probably benign 0.00
candle UTSW 6 124728419 missense probably damaging 1.00
farfalla_notturna UTSW 6 124732435 missense probably damaging 1.00
spin UTSW 6 124728559 missense probably damaging 0.99
spin2 UTSW 6 124732369 missense probably damaging 1.00
Vermeil UTSW 6 124732950 missense probably benign 0.10
R0183:Ptpn6 UTSW 6 124728951 missense probably damaging 1.00
R0254:Ptpn6 UTSW 6 124728150 missense probably damaging 1.00
R0636:Ptpn6 UTSW 6 124725279 missense probably benign
R0835:Ptpn6 UTSW 6 124727536 critical splice acceptor site probably null
R1638:Ptpn6 UTSW 6 124721185 missense probably benign
R1900:Ptpn6 UTSW 6 124728933 missense probably benign 0.15
R2047:Ptpn6 UTSW 6 124721789 missense probably benign 0.42
R2143:Ptpn6 UTSW 6 124724984 missense probably benign 0.01
R3907:Ptpn6 UTSW 6 124725276 missense possibly damaging 0.86
R4082:Ptpn6 UTSW 6 124728419 missense probably damaging 1.00
R4382:Ptpn6 UTSW 6 124727398 missense possibly damaging 0.86
R5319:Ptpn6 UTSW 6 124732950 missense probably benign 0.10
R5807:Ptpn6 UTSW 6 124724984 missense probably benign
R5878:Ptpn6 UTSW 6 124728785 missense probably damaging 1.00
R6056:Ptpn6 UTSW 6 124732435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACTCACTTGGAGGAAGTACGC -3'
(R):5'- ACGGGCACCATCATCGTCATTG -3'

Sequencing Primer
(F):5'- GAGGGTACGTGATATTCCCATAC -3'
(R):5'- GGCACCATCATCGTCATTGATATG -3'
Posted OnMar 17, 2014