Incidental Mutation 'R1385:Ocstamp'
ID163201
Institutional Source Beutler Lab
Gene Symbol Ocstamp
Ensembl Gene ENSMUSG00000027670
Gene Nameosteoclast stimulatory transmembrane protein
Synonyms
MMRRC Submission 039447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1385 (G1)
Quality Score150
Status Not validated
Chromosome2
Chromosomal Location165393760-165400405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165396039 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 435 (D435G)
Ref Sequence ENSEMBL: ENSMUSP00000029213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029213]
Predicted Effect probably benign
Transcript: ENSMUST00000029213
AA Change: D435G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029213
Gene: ENSMUSG00000027670
AA Change: D435G

DomainStartEndE-ValueType
transmembrane domain 52 71 N/A INTRINSIC
transmembrane domain 86 108 N/A INTRINSIC
transmembrane domain 121 140 N/A INTRINSIC
transmembrane domain 222 244 N/A INTRINSIC
Pfam:DC_STAMP 253 445 1.5e-35 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is orthologous to the mouse osteoclast stimulatory transmembrane protein (OCSTAMP), which is a membrane-anchored cell surface receptor that promotes nucleation of osteoclasts. The mouse protein is also involved in bone resorption and osteoclast differentiation. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective osteoclast fusion but normal skeletal paramaters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arf3 A G 15: 98,742,613 V43A probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cfap44 A G 16: 44,470,775 E1546G probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Itgbl1 A G 14: 123,661,511 probably null Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Scn9a G A 2: 66,563,542 P229L probably damaging Het
Serpinb5 A G 1: 106,876,123 T180A probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Xpo1 T C 11: 23,261,863 L8S probably damaging Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp119a T A 17: 55,865,826 H339L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Ocstamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02109:Ocstamp APN 2 165397336 missense possibly damaging 0.65
IGL02207:Ocstamp APN 2 165397663 missense possibly damaging 0.66
IGL02863:Ocstamp APN 2 165397508 missense probably damaging 1.00
R0309:Ocstamp UTSW 2 165395992 missense possibly damaging 0.75
R0402:Ocstamp UTSW 2 165396264 missense possibly damaging 0.55
R0590:Ocstamp UTSW 2 165397751 missense probably damaging 0.98
R0624:Ocstamp UTSW 2 165397852 missense probably damaging 0.97
R1657:Ocstamp UTSW 2 165397516 missense probably damaging 0.99
R1696:Ocstamp UTSW 2 165396174 missense probably damaging 1.00
R4371:Ocstamp UTSW 2 165397313 missense possibly damaging 0.66
R4746:Ocstamp UTSW 2 165396288 missense probably benign 0.40
R4815:Ocstamp UTSW 2 165398182 missense probably benign 0.01
R5979:Ocstamp UTSW 2 165397547 missense probably damaging 1.00
R6821:Ocstamp UTSW 2 165397922 missense probably benign 0.00
Z1088:Ocstamp UTSW 2 165395918 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGGTCCTCCCAAACGTCCAGTTAC -3'
(R):5'- ACGACTGTCATCTACCACAGGCTC -3'

Sequencing Primer
(F):5'- atcactgttgccacgcc -3'
(R):5'- GCTCAACCACCCCGTGTC -3'
Posted On2014-03-17