Incidental Mutation 'R1385:Serpinb5'
ID163193
Institutional Source Beutler Lab
Gene Symbol Serpinb5
Ensembl Gene ENSMUSG00000067006
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 5
Synonymsovalbumin, 1110036M19Rik, Maspin, Spi7
MMRRC Submission 039447-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R1385 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location106861173-106883348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106876123 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 180 (T180A)
Ref Sequence ENSEMBL: ENSMUSP00000108350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086701] [ENSMUST00000112729] [ENSMUST00000112730] [ENSMUST00000188745]
Predicted Effect probably damaging
Transcript: ENSMUST00000086701
AA Change: T180A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083908
Gene: ENSMUSG00000067006
AA Change: T180A

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112729
AA Change: T180A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108349
Gene: ENSMUSG00000067006
AA Change: T180A

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112730
AA Change: T180A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108350
Gene: ENSMUSG00000067006
AA Change: T180A

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188745
AA Change: T9A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140264
Gene: ENSMUSG00000067006
AA Change: T9A

DomainStartEndE-ValueType
Pfam:Serpin 1 74 1.6e-15 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele displayed peri-implantation lethality with impaired endoderm development and attenuated inner cell mass growth. Mice homozygous for another null allele were viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik AGAGGAGGAGGAGGAGG AGAGGAGGAGGAGG 9: 58,499,432 probably benign Het
Aldh7a1 A G 18: 56,542,285 S269P probably damaging Het
Arf3 A G 15: 98,742,613 V43A probably damaging Het
Arhgap1 C A 2: 91,670,831 N457K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ccdc39 C T 3: 33,821,412 E544K probably damaging Het
Cfap44 A G 16: 44,470,775 E1546G probably damaging Het
Cntn6 A G 6: 104,861,900 I900V probably benign Het
Edem1 A G 6: 108,846,684 N347S probably damaging Het
Erich6 A G 3: 58,636,830 I112T probably benign Het
Gemin2 A G 12: 59,018,146 probably null Het
Gm44 T A X: 90,892,268 C43S probably benign Het
Hunk T A 16: 90,472,486 V306E possibly damaging Het
Hydin A G 8: 110,523,204 I2260V probably benign Het
Itgbl1 A G 14: 123,661,511 probably null Het
Iws1 T A 18: 32,090,430 N630K probably benign Het
Lama2 C A 10: 27,224,043 R822L probably benign Het
Lrrc56 A G 7: 141,205,525 D130G probably damaging Het
Malrd1 A T 2: 16,042,228 I1722F unknown Het
Mark4 G T 7: 19,426,027 probably null Het
Muc5b T C 7: 141,862,137 V2940A probably benign Het
Mxd1 T A 6: 86,651,567 Q62L probably damaging Het
Ncapd2 A T 6: 125,173,115 S917T probably benign Het
Nr2c2 T G 6: 92,154,470 F171C probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nynrin A T 14: 55,864,899 Q675L probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Ocstamp T C 2: 165,396,039 D435G probably benign Het
Pdzd2 T C 15: 12,411,022 T553A probably benign Het
Pllp A G 8: 94,679,368 Y96H probably benign Het
Polg2 A G 11: 106,768,323 S455P probably damaging Het
Ppp1r9b A G 11: 94,992,211 T222A probably benign Het
Prkcd G A 14: 30,607,405 T26I probably damaging Het
Prkcq A G 2: 11,256,286 H383R probably damaging Het
Prune2 A G 19: 17,124,948 I2490M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Scn9a G A 2: 66,563,542 P229L probably damaging Het
Slc5a2 G C 7: 128,270,631 R412P probably damaging Het
Sphk2 A G 7: 45,712,291 I82T probably damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Treml1 T G 17: 48,360,198 V37G probably damaging Het
Trim33 A G 3: 103,310,950 K272E possibly damaging Het
Trpv6 T C 6: 41,621,129 D748G probably benign Het
Ubr4 A G 4: 139,402,612 H681R probably benign Het
Uhrf1bp1l A G 10: 89,790,641 N399S possibly damaging Het
Vmn2r82 A T 10: 79,396,491 R775* probably null Het
Xpo1 T C 11: 23,261,863 L8S probably damaging Het
Zfand4 G A 6: 116,273,638 G10R probably damaging Het
Zfp119a T A 17: 55,865,826 H339L probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Other mutations in Serpinb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Serpinb5 APN 1 106880326 missense probably benign 0.01
R1480:Serpinb5 UTSW 1 106881707 missense probably benign
R1497:Serpinb5 UTSW 1 106876052 missense probably benign 0.08
R1503:Serpinb5 UTSW 1 106870289 missense possibly damaging 0.76
R1933:Serpinb5 UTSW 1 106876121 missense probably damaging 0.99
R2400:Serpinb5 UTSW 1 106881952 missense probably damaging 0.98
R2567:Serpinb5 UTSW 1 106875146 missense probably benign 0.33
R2923:Serpinb5 UTSW 1 106876040 missense probably benign
R3148:Serpinb5 UTSW 1 106881825 missense probably damaging 1.00
R3820:Serpinb5 UTSW 1 106875072 nonsense probably null
R4667:Serpinb5 UTSW 1 106872295 missense probably benign 0.00
R4814:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4815:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4816:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4817:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R5369:Serpinb5 UTSW 1 106881757 missense possibly damaging 0.85
R6108:Serpinb5 UTSW 1 106881728 missense probably damaging 1.00
R6222:Serpinb5 UTSW 1 106870340 missense probably benign 0.09
R6251:Serpinb5 UTSW 1 106875065 missense possibly damaging 0.96
R6349:Serpinb5 UTSW 1 106881765 missense probably benign 0.44
R6936:Serpinb5 UTSW 1 106870418 missense probably benign 0.00
R6977:Serpinb5 UTSW 1 106872347 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AAACACCCCAGTCAGTTGTCTTTCC -3'
(R):5'- ACAATCCGGTGGCCTCTAGTTTGC -3'

Sequencing Primer
(F):5'- ATCCACTGCTGGAGTGAAC -3'
(R):5'- GCCTCTAGTTTGCTTTGTTTGC -3'
Posted On2014-03-17