Incidental Mutation 'R1482:Ankef1'
ID164426
Institutional Source Beutler Lab
Gene Symbol Ankef1
Ensembl Gene ENSMUSG00000074771
Gene Nameankyrin repeat and EF-hand domain containing 1
Synonyms
MMRRC Submission 039535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.042) question?
Stock #R1482 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location136501910-136562091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136550158 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 422 (K422N)
Ref Sequence ENSEMBL: ENSMUSP00000135947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028726] [ENSMUST00000121717] [ENSMUST00000123214] [ENSMUST00000149712] [ENSMUST00000180246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028726
AA Change: K422N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028726
Gene: ENSMUSG00000074771
AA Change: K422N

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 9e-6 BLAST
low complexity region 412 428 N/A INTRINSIC
ANK 524 553 1.19e-7 SMART
ANK 557 586 4.63e-5 SMART
ANK 590 619 1.54e-1 SMART
Blast:ANK 623 652 4e-10 BLAST
low complexity region 733 744 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121717
AA Change: K422N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113881
Gene: ENSMUSG00000074771
AA Change: K422N

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 9e-6 BLAST
low complexity region 412 428 N/A INTRINSIC
ANK 524 553 1.19e-7 SMART
ANK 557 586 4.63e-5 SMART
ANK 590 619 1.54e-1 SMART
Blast:ANK 623 652 4e-10 BLAST
low complexity region 733 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123214
SMART Domains Protein: ENSMUSP00000120000
Gene: ENSMUSG00000074771

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 4e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138967
Predicted Effect probably benign
Transcript: ENSMUST00000149712
SMART Domains Protein: ENSMUSP00000114440
Gene: ENSMUSG00000074771

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000180246
AA Change: K422N

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135947
Gene: ENSMUSG00000074771
AA Change: K422N

DomainStartEndE-ValueType
ANK 47 76 6.92e-4 SMART
ANK 80 109 5.21e1 SMART
ANK 113 144 1.96e3 SMART
ANK 148 179 1.07e2 SMART
ANK 184 213 3.85e-2 SMART
ANK 217 246 3.68e1 SMART
ANK 250 279 2.28e-4 SMART
Blast:ANK 283 312 9e-6 BLAST
low complexity region 412 428 N/A INTRINSIC
ANK 524 553 1.19e-7 SMART
ANK 557 586 4.63e-5 SMART
ANK 590 619 1.54e-1 SMART
Blast:ANK 623 652 4e-10 BLAST
low complexity region 733 744 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,717,192 D260N probably benign Het
AI314180 T C 4: 58,820,163 K1217E possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aqp6 A T 15: 99,604,307 *294C probably null Het
Baz2a T A 10: 128,109,008 M38K possibly damaging Het
Bcl2l14 A G 6: 134,427,302 D151G probably damaging Het
Cabp5 T A 7: 13,398,342 L12* probably null Het
Cachd1 T C 4: 100,988,598 V993A possibly damaging Het
Cd44 G A 2: 102,831,383 T306I probably damaging Het
Cdc20 A T 4: 118,437,056 N22K probably benign Het
Cdc6 T A 11: 98,916,981 D433E possibly damaging Het
Clhc1 A G 11: 29,553,725 D47G probably damaging Het
Csf2 T C 11: 54,248,563 K65E probably benign Het
Cul9 T C 17: 46,508,547 E2005G probably damaging Het
Dclk3 G T 9: 111,467,820 R144L possibly damaging Het
Dcpp2 C T 17: 23,900,542 T110I probably damaging Het
Disp1 A T 1: 183,086,474 F1461I possibly damaging Het
Dnah1 C T 14: 31,294,874 G1562D probably damaging Het
Exoc3l2 C A 7: 19,495,359 P234Q probably damaging Het
F2rl2 T C 13: 95,701,539 V364A probably benign Het
Fam151a T C 4: 106,745,679 L265P probably damaging Het
Fam151b T A 13: 92,450,166 Q253L probably benign Het
Fat1 G A 8: 44,953,244 V1011M probably benign Het
Fbxo6 G A 4: 148,145,984 R274* probably null Het
Fgd4 G T 16: 16,484,473 Q73K probably benign Het
Fth1 A G 19: 9,984,853 T154A probably benign Het
Hgs C A 11: 120,480,040 H572Q probably benign Het
Kcnk10 G A 12: 98,489,948 T208I probably damaging Het
Kdm5b G A 1: 134,624,897 V1204M probably damaging Het
Keg1 A C 19: 12,718,821 H166P probably damaging Het
Kifap3 A T 1: 163,825,859 N338I probably damaging Het
Llcfc1 A T 6: 41,685,284 D74V probably damaging Het
Lman2 A G 13: 55,351,405 V219A possibly damaging Het
Mettl25 A G 10: 105,826,590 I173T possibly damaging Het
Mov10 G T 3: 104,804,546 P170Q probably damaging Het
Mtif2 G T 11: 29,536,847 A286S probably damaging Het
Mtmr10 A G 7: 64,314,249 Y244C probably damaging Het
Nbea A T 3: 56,079,993 C359S probably damaging Het
Nbr1 C T 11: 101,572,841 T633I probably benign Het
Nepn A T 10: 52,400,416 T22S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Oacyl T A 18: 65,737,972 L342M probably damaging Het
Olfr691 T A 7: 105,337,256 R153S probably damaging Het
Olfr699 A G 7: 106,790,333 F223L probably benign Het
Olfr775 T A 10: 129,251,143 I203N possibly damaging Het
Olfr872 G A 9: 20,260,724 V295I possibly damaging Het
Oxnad1 T C 14: 32,099,633 probably null Het
Pard3b A T 1: 62,166,367 D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 D391A possibly damaging Het
Ptprk T C 10: 28,263,516 V79A probably benign Het
Rwdd2a A G 9: 86,574,278 D169G probably damaging Het
Scn3b A C 9: 40,279,496 D74A probably damaging Het
Setbp1 C T 18: 79,086,835 D61N probably damaging Het
Setx T A 2: 29,162,992 D2089E probably damaging Het
Vmn2r69 C G 7: 85,406,874 W685C probably damaging Het
Vps8 A G 16: 21,581,598 Q1272R probably benign Het
Wnk4 T C 11: 101,269,636 F699L probably damaging Het
Zfp616 T A 11: 74,083,977 N448K possibly damaging Het
Zfp618 C A 4: 63,115,448 D307E possibly damaging Het
Zfp687 A G 3: 95,007,533 F1219S probably damaging Het
Zfpm2 T A 15: 41,099,291 D248E probably damaging Het
Other mutations in Ankef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Ankef1 APN 2 136552531 missense possibly damaging 0.87
IGL02194:Ankef1 APN 2 136550509 missense probably benign 0.01
IGL02318:Ankef1 APN 2 136544775 missense possibly damaging 0.48
IGL02398:Ankef1 APN 2 136555782 missense probably damaging 0.98
IGL02930:Ankef1 APN 2 136550325 missense possibly damaging 0.79
R1692:Ankef1 UTSW 2 136550426 missense probably benign
R2045:Ankef1 UTSW 2 136554738 missense probably benign 0.00
R2074:Ankef1 UTSW 2 136545738 missense possibly damaging 0.62
R4952:Ankef1 UTSW 2 136550529 missense probably damaging 1.00
R5057:Ankef1 UTSW 2 136550360 unclassified probably null
R5113:Ankef1 UTSW 2 136552441 missense probably benign 0.20
R5743:Ankef1 UTSW 2 136549709 splice site probably null
R6120:Ankef1 UTSW 2 136550376 missense probably benign 0.04
R6243:Ankef1 UTSW 2 136537157 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCATAGAGCACGAGACTTCCCTTC -3'
(R):5'- CGATGTACCACTCGGAATCATCCTG -3'

Sequencing Primer
(F):5'- CGTAGTCAGCAAAGATGACTTC -3'
(R):5'- ACTCGGAATCATCCTGGATTG -3'
Posted On2014-03-28