Incidental Mutation 'R1465:Abca13'
ID165438
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene NameATP-binding cassette, sub-family A (ABC1), member 13
SynonymsA930002G16Rik
MMRRC Submission 039519-MU
Accession Numbers

NCBI RefSeq: NM_178259.3; MGI:2388707

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1465 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location9191942-9684259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9399303 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 3626 (G3626W)
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
Predicted Effect probably damaging
Transcript: ENSMUST00000042740
AA Change: G3626W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: G3626W

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 97.3%
  • 10x: 87.6%
  • 20x: 63.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310030G06Rik A G 9: 50,740,566 Y121H probably damaging Het
Acvr1c A G 2: 58,284,961 Y192H probably damaging Het
Afm A T 5: 90,550,341 D534V probably damaging Het
Agl T C 3: 116,771,372 E1076G probably benign Het
Angptl3 A T 4: 99,037,520 H361L probably benign Het
Apob T C 12: 8,011,421 F3301S possibly damaging Het
Arhgef33 T A 17: 80,367,301 C376S possibly damaging Het
Ass1 A G 2: 31,520,416 *413W probably null Het
Atp6v1h T A 1: 5,095,688 L127Q probably damaging Het
Bcl2l1 G A 2: 152,829,950 S14F probably damaging Het
Birc6 G A 17: 74,623,858 A2477T probably benign Het
Bpifb9a G A 2: 154,271,021 A589T possibly damaging Het
Casp9 C A 4: 141,805,840 T252K probably benign Het
Cct4 G A 11: 23,002,922 D533N probably damaging Het
Clcn6 A C 4: 148,013,901 I555S probably damaging Het
Col4a4 A T 1: 82,497,822 probably null Het
Cyp2d10 A T 15: 82,403,928 probably null Het
D930048N14Rik A G 11: 51,654,913 probably benign Het
Dlg5 T C 14: 24,154,696 probably null Het
Dnah11 T C 12: 118,038,695 E2240G probably damaging Het
Dnmt3a A G 12: 3,866,088 E17G probably damaging Het
Dock1 A G 7: 134,782,409 T670A probably benign Het
Dpy19l2 A G 9: 24,669,322 M241T probably benign Het
Dpy19l4 A G 4: 11,296,034 S212P probably damaging Het
Ephb6 T C 6: 41,616,106 F426S probably damaging Het
F5 A T 1: 164,198,833 D1658V probably benign Het
Faah A T 4: 115,999,558 V469E probably damaging Het
Fas T C 19: 34,316,613 C123R probably damaging Het
Fhod1 T C 8: 105,338,914 probably benign Het
Filip1 A G 9: 79,898,307 V55A probably benign Het
Frmpd1 G A 4: 45,273,197 R372Q probably damaging Het
Glyctk C T 9: 106,157,607 G87S probably damaging Het
Gm4737 T C 16: 46,153,848 K389E probably benign Het
Gm5096 T G 18: 87,757,258 F302V probably damaging Het
Golga3 T C 5: 110,209,878 L1080P probably damaging Het
Gpr137 T C 19: 6,938,444 T281A probably benign Het
Grap2 T A 15: 80,648,411 probably null Het
Hlcs T C 16: 94,268,292 D170G probably damaging Het
Hook1 A G 4: 96,013,256 T484A probably benign Het
Hoxa5 T A 6: 52,203,791 H187L probably benign Het
Inpp1 G T 1: 52,790,094 S255R probably benign Het
Inpp4b T A 8: 81,768,157 V67E probably damaging Het
Iqgap3 A G 3: 88,087,309 N105S probably damaging Het
Kcnq5 A G 1: 21,469,468 probably null Het
Klhl1 T C 14: 96,240,213 N473S probably benign Het
Klk1b24 C A 7: 44,191,361 T71N probably benign Het
Loxhd1 A G 18: 77,380,573 probably null Het
Lrp1b C T 2: 41,111,059 R2165Q probably benign Het
Lrp2bp A T 8: 46,025,235 Q328L possibly damaging Het
Lrrc63 T A 14: 75,107,389 K419N possibly damaging Het
Lrrc9 A G 12: 72,500,759 N150S probably benign Het
Lrrn4 C A 2: 132,872,075 C317F probably damaging Het
Ltbp2 T C 12: 84,813,300 S627G probably damaging Het
Macf1 A T 4: 123,493,154 S1224T probably damaging Het
Meis2 A C 2: 116,058,670 H200Q probably benign Het
Mesd C A 7: 83,895,582 A80E probably benign Het
Mroh2a G C 1: 88,257,802 E1510D probably damaging Het
Myo3a T C 2: 22,577,927 F398L probably benign Het
Nanp A G 2: 151,030,829 C60R probably benign Het
Nectin2 T G 7: 19,730,116 M313L probably benign Het
Nek4 C T 14: 30,956,887 H123Y probably damaging Het
Nploc4 A G 11: 120,408,781 V371A probably damaging Het
Olfr1463 T A 19: 13,234,901 V217E possibly damaging Het
Olfr156 A G 4: 43,820,723 F213L probably benign Het
Olfr658 T C 7: 104,644,946 N140S probably benign Het
Olfr740 A G 14: 50,453,177 T42A possibly damaging Het
Pcdh20 T A 14: 88,469,237 Q209L probably benign Het
Pcdhb20 G A 18: 37,504,697 R92H probably damaging Het
Pgap1 T C 1: 54,528,555 H377R probably benign Het
Phyhipl G T 10: 70,570,968 P52Q probably damaging Het
Pwwp2a T A 11: 43,705,556 V516E possibly damaging Het
Rack1 T C 11: 48,801,759 V69A probably damaging Het
Rexo5 T A 7: 119,801,358 probably null Het
Rock1 G T 18: 10,072,863 Q1161K possibly damaging Het
Rps6ka2 T C 17: 7,292,867 L568P probably damaging Het
Seh1l T C 18: 67,783,984 S78P probably damaging Het
Serpinb3b A T 1: 107,155,843 probably null Het
Setd1a T C 7: 127,788,340 probably benign Het
Setx G T 2: 29,140,389 probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Shc2 G T 10: 79,631,302 R146S probably damaging Het
Skap2 T C 6: 51,909,368 T5A probably benign Het
Slc35a3 T C 3: 116,687,334 I93M probably benign Het
Sohlh1 C T 2: 25,843,347 G295D probably damaging Het
Sult2a8 A C 7: 14,416,283 C168G probably benign Het
Tbc1d4 T C 14: 101,447,688 I1176V possibly damaging Het
Thada A T 17: 84,436,676 F735I possibly damaging Het
Tle1 A C 4: 72,139,831 H52Q probably damaging Het
Tmem101 A T 11: 102,153,329 V244E probably damaging Het
Tnfrsf26 C A 7: 143,617,931 C95F probably damaging Het
Uspl1 T C 5: 149,214,032 S482P probably benign Het
Vmn2r118 G T 17: 55,610,935 N192K probably benign Het
Vmn2r14 C T 5: 109,220,329 V266I possibly damaging Het
Vmn2r51 A G 7: 10,100,322 I263T probably damaging Het
Zfp937 T A 2: 150,239,047 C332* probably null Het
Zscan21 T A 5: 138,125,208 S50T probably benign Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9297443 missense probably benign 0.24
IGL00481:Abca13 APN 11 9290969 missense probably damaging 0.99
IGL00707:Abca13 APN 11 9291586 missense probably damaging 0.99
IGL00755:Abca13 APN 11 9542102 missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9290870 missense probably damaging 1.00
IGL00802:Abca13 APN 11 9297717 missense probably damaging 0.96
IGL00807:Abca13 APN 11 9378285 missense probably benign 0.10
IGL00977:Abca13 APN 11 9399284 missense probably damaging 1.00
IGL01064:Abca13 APN 11 9483855 missense probably benign 0.01
IGL01100:Abca13 APN 11 9274673 splice site probably null
IGL01290:Abca13 APN 11 9256232 missense probably damaging 1.00
IGL01299:Abca13 APN 11 9298743 missense probably benign 0.22
IGL01302:Abca13 APN 11 9399470 splice site probably benign
IGL01307:Abca13 APN 11 9297159 missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9292076 missense probably benign 0.05
IGL01351:Abca13 APN 11 9267565 missense probably benign 0.28
IGL01446:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01453:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01461:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01476:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01506:Abca13 APN 11 9297447 missense probably benign 0.36
IGL01527:Abca13 APN 11 9290788 missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9309020 missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9293527 missense probably benign 0.00
IGL01679:Abca13 APN 11 9298071 missense probably benign 0.07
IGL01731:Abca13 APN 11 9249749 splice site probably benign
IGL01762:Abca13 APN 11 9315423 missense probably benign 0.18
IGL01781:Abca13 APN 11 9399280 missense probably damaging 1.00
IGL01802:Abca13 APN 11 9292438 missense probably benign 0.00
IGL01809:Abca13 APN 11 9290339 missense probably damaging 0.96
IGL01906:Abca13 APN 11 9216225 missense probably damaging 1.00
IGL01928:Abca13 APN 11 9683342 missense probably benign 0.13
IGL01940:Abca13 APN 11 9567661 splice site probably benign
IGL01993:Abca13 APN 11 9258452 unclassified probably benign
IGL02039:Abca13 APN 11 9297193 nonsense probably null
IGL02159:Abca13 APN 11 9314545 missense probably benign 0.00
IGL02202:Abca13 APN 11 9288529 missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9290626 missense probably benign 0.00
IGL02332:Abca13 APN 11 9291482 missense probably damaging 0.98
IGL02380:Abca13 APN 11 9291599 missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9297527 missense probably benign 0.00
IGL02505:Abca13 APN 11 9581498 missense probably damaging 1.00
IGL02507:Abca13 APN 11 9399388 missense probably damaging 1.00
IGL02558:Abca13 APN 11 9399387 missense probably damaging 1.00
IGL02581:Abca13 APN 11 9399132 splice site probably benign
IGL02586:Abca13 APN 11 9293983 missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9431898 missense probably damaging 1.00
IGL02747:Abca13 APN 11 9373282 nonsense probably null
IGL02893:Abca13 APN 11 9290543 missense probably damaging 0.96
IGL02930:Abca13 APN 11 9378226 missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9378291 missense probably damaging 0.99
IGL02983:Abca13 APN 11 9290663 missense probably benign 0.40
IGL02999:Abca13 APN 11 9581757 splice site probably benign
IGL03100:Abca13 APN 11 9258527 missense probably benign 0.25
IGL03114:Abca13 APN 11 9528999 missense probably benign 0.06
IGL03230:Abca13 APN 11 9294313 missense probably benign 0.02
IGL03329:Abca13 APN 11 9298047 missense probably benign 0.08
IGL03380:Abca13 APN 11 9298574 missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9451515 missense probably damaging 1.00
R0017:Abca13 UTSW 11 9292775 missense probably damaging 0.99
R0079:Abca13 UTSW 11 9293493 missense probably benign 0.00
R0089:Abca13 UTSW 11 9292886 missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0113:Abca13 UTSW 11 9292114 missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0152:Abca13 UTSW 11 9581724 missense probably damaging 0.98
R0255:Abca13 UTSW 11 9581545 missense probably damaging 1.00
R0277:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0278:Abca13 UTSW 11 9378215 missense probably damaging 1.00
R0294:Abca13 UTSW 11 9269122 splice site probably null
R0299:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0310:Abca13 UTSW 11 9293810 missense probably benign 0.36
R0317:Abca13 UTSW 11 9293459 missense probably damaging 1.00
R0323:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0324:Abca13 UTSW 11 9297669 missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9399430 missense probably damaging 0.97
R0336:Abca13 UTSW 11 9298481 missense probably benign 0.04
R0346:Abca13 UTSW 11 9566278 missense probably damaging 0.99
R0380:Abca13 UTSW 11 9588500 splice site probably null
R0382:Abca13 UTSW 11 9636650 splice site probably benign
R0482:Abca13 UTSW 11 9328207 missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9331687 missense probably benign 0.07
R0491:Abca13 UTSW 11 9298235 missense probably benign 0.02
R0496:Abca13 UTSW 11 9291701 missense probably benign 0.01
R0505:Abca13 UTSW 11 9291058 missense probably benign 0.00
R0511:Abca13 UTSW 11 9294559 missense probably benign
R0525:Abca13 UTSW 11 9293371 missense probably damaging 1.00
R0538:Abca13 UTSW 11 9267622 critical splice donor site probably null
R0615:Abca13 UTSW 11 9256197 missense probably damaging 0.96
R0634:Abca13 UTSW 11 9314491 missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9588508 splice site probably benign
R0848:Abca13 UTSW 11 9682011 nonsense probably null
R0883:Abca13 UTSW 11 9291238 nonsense probably null
R0892:Abca13 UTSW 11 9298305 missense probably benign 0.00
R0904:Abca13 UTSW 11 9298740 missense probably benign 0.22
R0968:Abca13 UTSW 11 9298016 missense probably benign 0.00
R1187:Abca13 UTSW 11 9528981 missense probably benign 0.00
R1299:Abca13 UTSW 11 9294821 missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9291836 missense probably benign
R1387:Abca13 UTSW 11 9682085 nonsense probably null
R1436:Abca13 UTSW 11 9292646 missense probably damaging 0.99
R1449:Abca13 UTSW 11 9298580 missense probably damaging 1.00
R1450:Abca13 UTSW 11 9430531 splice site probably benign
R1462:Abca13 UTSW 11 9483924 splice site probably benign
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1466:Abca13 UTSW 11 9570536 splice site probably benign
R1494:Abca13 UTSW 11 9466429 nonsense probably null
R1559:Abca13 UTSW 11 9399180 missense probably null 1.00
R1564:Abca13 UTSW 11 9434316 nonsense probably null
R1698:Abca13 UTSW 11 9314507 missense probably benign 0.13
R1728:Abca13 UTSW 11 9249680 missense probably benign 0.02
R1734:Abca13 UTSW 11 9585460 missense probably benign 0.03
R1781:Abca13 UTSW 11 9269194 missense probably damaging 1.00
R1782:Abca13 UTSW 11 9297971 missense probably benign 0.36
R1807:Abca13 UTSW 11 9291755 missense probably damaging 0.98
R1830:Abca13 UTSW 11 9290350 missense probably benign 0.04
R1869:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1870:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1871:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1903:Abca13 UTSW 11 9466411 missense probably benign 0.13
R1916:Abca13 UTSW 11 9534456 missense probably damaging 1.00
R1936:Abca13 UTSW 11 9293595 missense probably benign 0.13
R1976:Abca13 UTSW 11 9397815 missense probably damaging 1.00
R2001:Abca13 UTSW 11 9273967 missense probably benign 0.01
R2007:Abca13 UTSW 11 9191987 missense probably benign 0.19
R2016:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2017:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2034:Abca13 UTSW 11 9292628 missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9328098 missense probably benign 0.04
R2075:Abca13 UTSW 11 9522382 missense probably damaging 1.00
R2118:Abca13 UTSW 11 9309013 splice site probably benign
R2120:Abca13 UTSW 11 9309013 splice site probably benign
R2124:Abca13 UTSW 11 9309013 splice site probably benign
R2148:Abca13 UTSW 11 9615764 missense probably damaging 1.00
R2149:Abca13 UTSW 11 9267508 missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9577170 missense probably damaging 0.97
R2167:Abca13 UTSW 11 9288532 missense probably benign 0.19
R2261:Abca13 UTSW 11 9292288 missense probably benign
R2263:Abca13 UTSW 11 9274702 missense probably benign 0.04
R2281:Abca13 UTSW 11 9328136 missense probably damaging 0.98
R2340:Abca13 UTSW 11 9399165 missense probably damaging 0.99
R2357:Abca13 UTSW 11 9297336 missense probably damaging 1.00
R2370:Abca13 UTSW 11 9256185 missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9267450 splice site probably benign
R2393:Abca13 UTSW 11 9275057 nonsense probably null
R2432:Abca13 UTSW 11 9451333 splice site probably benign
R2446:Abca13 UTSW 11 9275101 missense probably benign
R2568:Abca13 UTSW 11 9333310 missense probably benign 0.40
R2847:Abca13 UTSW 11 9294584 missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2861:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2862:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2877:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9316119 splice site probably benign
R3789:Abca13 UTSW 11 9510668 missense probably damaging 0.97
R3933:Abca13 UTSW 11 9354856 missense probably damaging 1.00
R3981:Abca13 UTSW 11 9532407 missense probably benign
R4002:Abca13 UTSW 11 9585415 missense probably benign 0.00
R4010:Abca13 UTSW 11 9622013 splice site probably benign
R4011:Abca13 UTSW 11 9622013 splice site probably benign
R4127:Abca13 UTSW 11 9191973 missense probably benign 0.00
R4214:Abca13 UTSW 11 9293877 missense probably damaging 0.96
R4236:Abca13 UTSW 11 9256205 missense probably damaging 1.00
R4237:Abca13 UTSW 11 9434188 missense probably benign 0.01
R4359:Abca13 UTSW 11 9297629 missense probably benign 0.02
R4378:Abca13 UTSW 11 9293644 missense probably benign 0.00
R4389:Abca13 UTSW 11 9297878 missense probably damaging 0.98
R4392:Abca13 UTSW 11 9309034 missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9309130 missense probably damaging 1.00
R4684:Abca13 UTSW 11 9434193 nonsense probably null
R4691:Abca13 UTSW 11 9434195 missense probably damaging 1.00
R4700:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9276990 missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9277973 critical splice donor site probably null
R4772:Abca13 UTSW 11 9315339 splice site probably null
R4782:Abca13 UTSW 11 9328096 missense probably damaging 0.96
R4801:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4802:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9290421 missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9542077 nonsense probably null
R4851:Abca13 UTSW 11 9483890 missense probably benign 0.02
R4857:Abca13 UTSW 11 9294143 missense probably benign 0.22
R4869:Abca13 UTSW 11 9315434 splice site probably null
R4982:Abca13 UTSW 11 9292348 missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9297678 missense probably damaging 0.99
R5044:Abca13 UTSW 11 9373323 missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9258535 missense probably damaging 1.00
R5155:Abca13 UTSW 11 9532447 missense probably damaging 0.98
R5173:Abca13 UTSW 11 9682032 frame shift probably null
R5180:Abca13 UTSW 11 9466510 missense probably benign 0.01
R5244:Abca13 UTSW 11 9275081 missense probably benign 0.28
R5257:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9431861 missense probably damaging 1.00
R5363:Abca13 UTSW 11 9277035 missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9628629 missense probably damaging 1.00
R5419:Abca13 UTSW 11 9193533 critical splice donor site probably null
R5426:Abca13 UTSW 11 9290722 missense probably damaging 1.00
R5468:Abca13 UTSW 11 9294062 missense probably damaging 1.00
R5477:Abca13 UTSW 11 9301298 missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9291545 missense probably benign 0.00
R5553:Abca13 UTSW 11 9328158 missense probably damaging 1.00
R5556:Abca13 UTSW 11 9258546 missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9294615 nonsense probably null
R5582:Abca13 UTSW 11 9636639 splice site probably null
R5604:Abca13 UTSW 11 9566279 missense probably damaging 0.97
R5609:Abca13 UTSW 11 9403874 missense probably benign 0.01
R5617:Abca13 UTSW 11 9277891 missense probably benign 0.00
R5693:Abca13 UTSW 11 9316233 missense probably benign 0.29
R5707:Abca13 UTSW 11 9510620 missense probably damaging 1.00
R5725:Abca13 UTSW 11 9577181 missense probably benign 0.00
R5728:Abca13 UTSW 11 9570576 missense probably damaging 1.00
R5738:Abca13 UTSW 11 9621917 missense probably damaging 1.00
R5758:Abca13 UTSW 11 9314536 missense probably damaging 0.97
R5762:Abca13 UTSW 11 9581665 missense probably damaging 1.00
R5771:Abca13 UTSW 11 9291411 missense probably damaging 1.00
R5809:Abca13 UTSW 11 9293692 missense probably damaging 1.00
R5826:Abca13 UTSW 11 9682056 missense probably damaging 0.99
R5831:Abca13 UTSW 11 9567777 nonsense probably null
R5834:Abca13 UTSW 11 9277974 critical splice donor site probably null
R5902:Abca13 UTSW 11 9297177 missense probably damaging 1.00
R5933:Abca13 UTSW 11 9249658 missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9293398 missense probably benign 0.04
R5969:Abca13 UTSW 11 9292214 nonsense probably null
R5985:Abca13 UTSW 11 9291628 missense probably benign 0.02
R5998:Abca13 UTSW 11 9567708 missense probably damaging 0.97
R6021:Abca13 UTSW 11 9290465 nonsense probably null
R6022:Abca13 UTSW 11 9290759 missense probably damaging 1.00
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9397812 missense probably damaging 1.00
R6153:Abca13 UTSW 11 9301259 critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9309047 missense probably damaging 1.00
R6187:Abca13 UTSW 11 9309085 missense probably damaging 1.00
R6247:Abca13 UTSW 11 9403874 missense probably benign 0.01
R6329:Abca13 UTSW 11 9277937 missense probably damaging 1.00
R6352:Abca13 UTSW 11 9309139 splice site probably null
R6367:Abca13 UTSW 11 9216248 missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9298778 missense probably benign 0.01
R6424:Abca13 UTSW 11 9510542 missense probably benign
R6456:Abca13 UTSW 11 9290474 missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9298661 missense probably benign 0.00
R6547:Abca13 UTSW 11 9274757 missense probably benign 0.04
R6594:Abca13 UTSW 11 9294632 missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9378384 missense probably damaging 1.00
R6614:Abca13 UTSW 11 9294371 missense probably benign 0.04
R6736:Abca13 UTSW 11 9465058 missense probably damaging 1.00
R6742:Abca13 UTSW 11 9328168 missense probably damaging 1.00
R6791:Abca13 UTSW 11 9378504 missense probably damaging 1.00
R6834:Abca13 UTSW 11 9275110 missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9298568 missense probably damaging 0.96
R6955:Abca13 UTSW 11 9294307 missense probably benign 0.28
X0013:Abca13 UTSW 11 9273899 missense probably benign 0.02
X0057:Abca13 UTSW 11 9294744 missense probably damaging 0.96
X0066:Abca13 UTSW 11 9267565 missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9294687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTGGGTTGGCAAACCAAATG -3'
(R):5'- AGAGCCGCTTACTCACCAGAAGAG -3'

Sequencing Primer
(F):5'- TGCAGTGATAACCCCAGGC -3'
(R):5'- CTTACTCACCAGAAGAGTCTGAATAG -3'
Posted On2014-03-28