Incidental Mutation 'R4802:Abca13'
ID370319
Institutional Source Beutler Lab
Gene Symbol Abca13
Ensembl Gene ENSMUSG00000004668
Gene NameATP-binding cassette, sub-family A (ABC1), member 13
SynonymsA930002G16Rik
MMRRC Submission 042424-MU
Accession Numbers

NCBI RefSeq: NM_178259.3; MGI:2388707

Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4802 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location9191942-9684259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9522341 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 4249 (G4249V)
Ref Sequence ENSEMBL: ENSMUSP00000040465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042740
AA Change: G4249V

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040465
Gene: ENSMUSG00000004668
AA Change: G4249V

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 358 379 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
low complexity region 820 831 N/A INTRINSIC
low complexity region 1382 1393 N/A INTRINSIC
low complexity region 1721 1737 N/A INTRINSIC
low complexity region 1859 1872 N/A INTRINSIC
Pfam:ABC2_membrane_3 3288 3740 4.7e-21 PFAM
low complexity region 3796 3809 N/A INTRINSIC
AAA 3835 4019 8.08e-12 SMART
transmembrane domain 4206 4228 N/A INTRINSIC
Pfam:ABC2_membrane_3 4317 4646 1.6e-33 PFAM
AAA 4721 4909 8.86e-9 SMART
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 97% (93/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(3) : Targeted(3

Other mutations in this stock
Total: 167 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,983,926 probably null Het
4932416K20Rik T A 8: 104,797,032 noncoding transcript Het
Aadacl3 A G 4: 144,456,232 I222T probably damaging Het
Abcb10 A G 8: 123,966,527 V346A probably benign Het
Abcc2 A T 19: 43,819,361 I814F probably damaging Het
AF366264 T A 8: 13,836,970 I374F possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd28 A C 14: 31,736,830 D335E probably damaging Het
Ankrd44 T C 1: 54,762,316 H284R probably damaging Het
Arfgef3 G T 10: 18,591,906 Q1849K probably benign Het
Bach1 T A 16: 87,722,452 D543E probably damaging Het
Bahcc1 G A 11: 120,282,225 V1558I probably benign Het
Bbs5 T A 2: 69,655,614 W168R probably damaging Het
Bcar3 A T 3: 122,529,594 D766V probably benign Het
C1ra A G 6: 124,513,768 D40G probably benign Het
Cbr4 T C 8: 61,490,079 probably benign Het
Ccdc138 G A 10: 58,573,643 C598Y probably damaging Het
Cd200r3 T A 16: 44,957,825 N197K possibly damaging Het
Cenpf T A 1: 189,651,220 E2634D probably damaging Het
Cisd2 T C 3: 135,411,141 K63R probably damaging Het
Clca3a2 A T 3: 144,807,351 S478T possibly damaging Het
Clptm1l T C 13: 73,607,862 M199T possibly damaging Het
Cntnap4 T A 8: 112,773,590 S505T possibly damaging Het
Cr2 C T 1: 195,163,311 G112D probably damaging Het
Crb2 T A 2: 37,793,756 I1090N probably benign Het
Csmd3 G T 15: 47,621,292 P3057Q probably damaging Het
Ctso G A 3: 81,954,240 V307I probably damaging Het
Cyp3a41b T A 5: 145,573,651 T138S probably benign Het
Dctn3 G T 4: 41,719,904 Y67* probably null Het
Dennd4c C A 4: 86,819,884 Y918* probably null Het
Dlg5 C T 14: 24,154,689 G1262D probably damaging Het
Dnaaf1 G A 8: 119,577,361 G46D probably benign Het
Dnah6 A G 6: 73,089,698 V2563A probably damaging Het
Dnajc13 A G 9: 104,175,727 Y1679H probably benign Het
Eif2ak3 T C 6: 70,887,893 Y578H probably benign Het
Endod1 C T 9: 14,357,023 V389M probably benign Het
Entpd2 T G 2: 25,399,764 probably null Het
Ephb4 T C 5: 137,365,506 L582P probably damaging Het
Eps15 T C 4: 109,324,217 L316S possibly damaging Het
Erbb4 G T 1: 68,330,246 T412K probably damaging Het
Fam117a T A 11: 95,364,070 F90I probably damaging Het
Fam187b T G 7: 30,977,090 V8G possibly damaging Het
Fam84b C A 15: 60,823,944 probably benign Het
Far1 T A 7: 113,539,453 I59N possibly damaging Het
Fbxo34 T A 14: 47,530,869 L562Q probably damaging Het
Frem1 T A 4: 82,916,628 probably benign Het
Gfra3 G T 18: 34,720,192 P10Q probably damaging Het
Gm10619 T A 7: 73,810,025 noncoding transcript Het
Gm11487 C T 4: 73,401,267 W80* probably null Het
Gm19965 T A 1: 116,821,896 Y436N probably benign Het
Gm21818 T A 13: 120,173,222 S13R probably benign Het
Gm28042 T C 2: 120,042,054 probably benign Het
Gm4953 A T 1: 159,168,418 noncoding transcript Het
Gm5799 A T 14: 43,544,548 H59L probably damaging Het
Gmppb T A 9: 108,050,217 V121E probably benign Het
Ighv7-4 G C 12: 114,223,279 probably benign Het
Ipo4 A G 14: 55,631,214 S446P probably damaging Het
Itpr2 T C 6: 146,371,331 T855A probably damaging Het
Jaml T C 9: 45,101,064 I283T possibly damaging Het
Klhl32 T C 4: 24,649,698 Y399C possibly damaging Het
Lrriq1 G A 10: 103,221,318 T207I probably benign Het
Lrriq3 A T 3: 155,187,970 H436L probably benign Het
Mad2l1bp T C 17: 46,148,263 K114E possibly damaging Het
Mamstr T C 7: 45,642,418 V64A possibly damaging Het
Map4 T A 9: 110,035,257 S517T probably benign Het
Matn1 A T 4: 130,950,025 I182F possibly damaging Het
Mcm3 A G 1: 20,810,156 I484T probably damaging Het
Med13 T A 11: 86,278,773 I1922F probably damaging Het
Metap2 A G 10: 93,868,895 V137A probably damaging Het
Mex3d A G 10: 80,386,954 V156A possibly damaging Het
Mfsd6 G A 1: 52,709,596 P37S probably benign Het
Mkl1 T C 15: 81,104,799 E7G probably benign Het
Mrgprx1 A C 7: 48,021,211 S263A possibly damaging Het
Msl1 C T 11: 98,803,969 R505* probably null Het
Mta2 T C 19: 8,945,851 S96P probably damaging Het
Mtr A T 13: 12,195,251 N986K probably benign Het
Mut A G 17: 40,937,351 T90A probably benign Het
Mutyh C T 4: 116,817,029 T259I probably benign Het
Myof T C 19: 37,945,738 T908A probably benign Het
Nav2 A T 7: 49,545,852 D992V possibly damaging Het
Neb T C 2: 52,200,703 T1352A possibly damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nudt19 T C 7: 35,556,139 probably benign Het
Nudt6 G A 3: 37,405,354 R161C probably benign Het
Olfr1122 T A 2: 87,388,209 V168E probably benign Het
Olfr1173 T A 2: 88,274,879 M57L probably damaging Het
Olfr125 T C 17: 37,835,349 Y117H probably damaging Het
Olfr1276 T A 2: 111,257,152 F12L probably damaging Het
Olfr1411 T A 1: 92,596,998 C160S probably benign Het
Olfr154 T A 2: 85,664,278 D52V probably damaging Het
Olfr23 T A 11: 73,940,870 I208K possibly damaging Het
Olfr319 T C 11: 58,701,791 V30A probably benign Het
Olfr456 A T 6: 42,486,679 N171K probably benign Het
Olfr744 A G 14: 50,619,022 T267A probably benign Het
Olfr959 T G 9: 39,572,858 M134L probably benign Het
Olr1 A G 6: 129,488,090 F141S possibly damaging Het
Oprl1 G T 2: 181,719,253 M340I probably benign Het
Otogl A C 10: 107,901,336 C72W probably damaging Het
Pcdha11 T A 18: 37,005,465 I49N probably damaging Het
Pcdha4 T A 18: 36,953,955 L397* probably null Het
Pcdhb14 A G 18: 37,448,278 S146G probably benign Het
Pclo T A 5: 14,675,815 H1562Q unknown Het
Pcsk9 T C 4: 106,447,569 E434G probably benign Het
Phc2 A G 4: 128,751,598 K833E probably damaging Het
Pja2 A T 17: 64,292,862 S480R probably damaging Het
Pkd1 G A 17: 24,578,096 G2493D probably damaging Het
Plk5 G A 10: 80,359,304 V179M possibly damaging Het
Polr1a G A 6: 71,976,070 V1541I probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Ppp1r14a A G 7: 29,291,526 D73G probably damaging Het
Psd3 C T 8: 68,121,148 R127H probably benign Het
Pten G T 19: 32,758,503 G20V possibly damaging Het
Ptprf G A 4: 118,210,329 probably benign Het
Rad54l T C 4: 116,122,924 D21G probably null Het
Rgs14 T C 13: 55,380,957 Y304H probably damaging Het
Rgs9 T C 11: 109,240,868 K346R probably damaging Het
Rnf169 C G 7: 99,926,446 G314A probably damaging Het
Rpgrip1l T A 8: 91,270,177 T692S probably damaging Het
Rtf1 T C 2: 119,675,228 V54A possibly damaging Het
Rtn4 T C 11: 29,708,660 V938A probably benign Het
Ryr2 T C 13: 11,708,227 T2509A probably damaging Het
Ryr2 T A 13: 11,687,932 D2890V probably damaging Het
Scel A C 14: 103,583,100 T348P probably benign Het
Scgb1b2 G T 7: 31,291,573 L37I possibly damaging Het
Sdf4 A G 4: 156,000,721 H171R possibly damaging Het
Sec31a A G 5: 100,393,363 V295A probably damaging Het
Setx T A 2: 29,146,373 S957T probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Six5 A G 7: 19,096,969 N507S probably benign Het
Slc12a7 T C 13: 73,763,892 probably null Het
Slc1a7 T A 4: 107,993,040 V116E probably damaging Het
Slc22a1 A G 17: 12,675,535 L42P probably damaging Het
Slc25a31 A T 3: 40,721,545 I174F probably damaging Het
Slc31a2 A T 4: 62,292,632 M3L probably damaging Het
Slco1a4 T A 6: 141,845,497 probably benign Het
Smcr8 C T 11: 60,778,610 probably null Het
Smg5 G T 3: 88,355,692 E801* probably null Het
Smgc C A 15: 91,854,616 H492Q probably benign Het
Smyd4 G T 11: 75,403,184 G694V probably damaging Het
Sorcs3 A G 19: 48,398,744 T223A possibly damaging Het
Stab1 G T 14: 31,141,371 C2119* probably null Het
Taar9 A G 10: 24,108,843 I231T probably damaging Het
Tacr2 A G 10: 62,261,548 Y269C probably damaging Het
Taf3 T G 2: 9,951,123 K744N possibly damaging Het
Tarbp1 C G 8: 126,474,889 E59D possibly damaging Het
Tenm4 T A 7: 96,906,245 V2682E probably damaging Het
Tet1 A C 10: 62,822,663 L1468R probably damaging Het
Tgfb2 A T 1: 186,628,913 Y380* probably null Het
Tgm5 T G 2: 121,052,472 K435Q probably damaging Het
Themis A G 10: 28,761,511 T204A probably benign Het
Tm4sf1 T C 3: 57,294,679 Y37C probably damaging Het
Tnn T C 1: 160,145,033 N333S possibly damaging Het
Tppp2 A G 14: 51,919,348 N61D probably benign Het
Treml2 A G 17: 48,309,159 T276A probably benign Het
Trit1 T C 4: 123,016,638 V10A probably benign Het
Ttn T A 2: 76,964,646 probably benign Het
Uba1y T G Y: 825,890 probably null Het
Vcam1 C G 3: 116,115,935 G581A probably damaging Het
Vmn1r16 G A 6: 57,323,190 T149I probably benign Het
Vmn1r209 T C 13: 22,805,656 D288G probably damaging Het
Vmn1r78 T A 7: 12,152,964 Y167* probably null Het
Vmn2r103 T A 17: 19,795,076 S493T probably benign Het
Vmn2r105 T A 17: 20,227,294 M423L probably benign Het
Vps13c T C 9: 67,964,282 F3244L probably damaging Het
Zfp119b A T 17: 55,939,642 D149E probably damaging Het
Zfp345 T C 2: 150,473,308 Y103C possibly damaging Het
Zmym6 C T 4: 127,123,216 T930I probably benign Het
Other mutations in Abca13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Abca13 APN 11 9297443 missense probably benign 0.24
IGL00481:Abca13 APN 11 9290969 missense probably damaging 0.99
IGL00707:Abca13 APN 11 9291586 missense probably damaging 0.99
IGL00755:Abca13 APN 11 9542102 missense possibly damaging 0.87
IGL00771:Abca13 APN 11 9290870 missense probably damaging 1.00
IGL00802:Abca13 APN 11 9297717 missense probably damaging 0.96
IGL00807:Abca13 APN 11 9378285 missense probably benign 0.10
IGL00977:Abca13 APN 11 9399284 missense probably damaging 1.00
IGL01064:Abca13 APN 11 9483855 missense probably benign 0.01
IGL01100:Abca13 APN 11 9274673 splice site probably null
IGL01290:Abca13 APN 11 9256232 missense probably damaging 1.00
IGL01299:Abca13 APN 11 9298743 missense probably benign 0.22
IGL01302:Abca13 APN 11 9399470 splice site probably benign
IGL01307:Abca13 APN 11 9297159 missense possibly damaging 0.86
IGL01349:Abca13 APN 11 9292076 missense probably benign 0.05
IGL01351:Abca13 APN 11 9267565 missense probably benign 0.28
IGL01446:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01453:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01461:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01476:Abca13 APN 11 9403834 missense probably damaging 0.97
IGL01506:Abca13 APN 11 9297447 missense probably benign 0.36
IGL01527:Abca13 APN 11 9290788 missense possibly damaging 0.49
IGL01559:Abca13 APN 11 9309020 missense possibly damaging 0.82
IGL01580:Abca13 APN 11 9293527 missense probably benign 0.00
IGL01679:Abca13 APN 11 9298071 missense probably benign 0.07
IGL01731:Abca13 APN 11 9249749 splice site probably benign
IGL01762:Abca13 APN 11 9315423 missense probably benign 0.18
IGL01781:Abca13 APN 11 9399280 missense probably damaging 1.00
IGL01802:Abca13 APN 11 9292438 missense probably benign 0.00
IGL01809:Abca13 APN 11 9290339 missense probably damaging 0.96
IGL01906:Abca13 APN 11 9216225 missense probably damaging 1.00
IGL01928:Abca13 APN 11 9683342 missense probably benign 0.13
IGL01940:Abca13 APN 11 9567661 splice site probably benign
IGL01993:Abca13 APN 11 9258452 unclassified probably benign
IGL02039:Abca13 APN 11 9297193 nonsense probably null
IGL02159:Abca13 APN 11 9314545 missense probably benign 0.00
IGL02202:Abca13 APN 11 9288529 missense possibly damaging 0.55
IGL02268:Abca13 APN 11 9290626 missense probably benign 0.00
IGL02332:Abca13 APN 11 9291482 missense probably damaging 0.98
IGL02380:Abca13 APN 11 9291599 missense possibly damaging 0.73
IGL02466:Abca13 APN 11 9297527 missense probably benign 0.00
IGL02505:Abca13 APN 11 9581498 missense probably damaging 1.00
IGL02507:Abca13 APN 11 9399388 missense probably damaging 1.00
IGL02558:Abca13 APN 11 9399387 missense probably damaging 1.00
IGL02581:Abca13 APN 11 9399132 splice site probably benign
IGL02586:Abca13 APN 11 9293983 missense possibly damaging 0.56
IGL02598:Abca13 APN 11 9431898 missense probably damaging 1.00
IGL02747:Abca13 APN 11 9373282 nonsense probably null
IGL02893:Abca13 APN 11 9290543 missense probably damaging 0.96
IGL02930:Abca13 APN 11 9378226 missense possibly damaging 0.86
IGL02967:Abca13 APN 11 9378291 missense probably damaging 0.99
IGL02983:Abca13 APN 11 9290663 missense probably benign 0.40
IGL02999:Abca13 APN 11 9581757 splice site probably benign
IGL03100:Abca13 APN 11 9258527 missense probably benign 0.25
IGL03114:Abca13 APN 11 9528999 missense probably benign 0.06
IGL03230:Abca13 APN 11 9294313 missense probably benign 0.02
IGL03329:Abca13 APN 11 9298047 missense probably benign 0.08
IGL03380:Abca13 APN 11 9298574 missense probably benign 0.10
IGL02835:Abca13 UTSW 11 9451515 missense probably damaging 1.00
R0017:Abca13 UTSW 11 9292775 missense probably damaging 0.99
R0079:Abca13 UTSW 11 9293493 missense probably benign 0.00
R0089:Abca13 UTSW 11 9292886 missense possibly damaging 0.76
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0103:Abca13 UTSW 11 9273951 missense probably damaging 1.00
R0113:Abca13 UTSW 11 9292114 missense possibly damaging 0.54
R0119:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0152:Abca13 UTSW 11 9581724 missense probably damaging 0.98
R0255:Abca13 UTSW 11 9581545 missense probably damaging 1.00
R0277:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0278:Abca13 UTSW 11 9378215 missense probably damaging 1.00
R0294:Abca13 UTSW 11 9269122 splice site probably null
R0299:Abca13 UTSW 11 9298076 missense probably benign 0.03
R0310:Abca13 UTSW 11 9293810 missense probably benign 0.36
R0317:Abca13 UTSW 11 9293459 missense probably damaging 1.00
R0323:Abca13 UTSW 11 9294701 missense probably benign 0.25
R0324:Abca13 UTSW 11 9297669 missense possibly damaging 0.76
R0329:Abca13 UTSW 11 9399430 missense probably damaging 0.97
R0336:Abca13 UTSW 11 9298481 missense probably benign 0.04
R0346:Abca13 UTSW 11 9566278 missense probably damaging 0.99
R0380:Abca13 UTSW 11 9588500 splice site probably null
R0382:Abca13 UTSW 11 9636650 splice site probably benign
R0482:Abca13 UTSW 11 9328207 missense possibly damaging 0.88
R0487:Abca13 UTSW 11 9331687 missense probably benign 0.07
R0491:Abca13 UTSW 11 9298235 missense probably benign 0.02
R0496:Abca13 UTSW 11 9291701 missense probably benign 0.01
R0505:Abca13 UTSW 11 9291058 missense probably benign 0.00
R0511:Abca13 UTSW 11 9294559 missense probably benign
R0525:Abca13 UTSW 11 9293371 missense probably damaging 1.00
R0538:Abca13 UTSW 11 9267622 critical splice donor site probably null
R0615:Abca13 UTSW 11 9256197 missense probably damaging 0.96
R0634:Abca13 UTSW 11 9314491 missense possibly damaging 0.59
R0699:Abca13 UTSW 11 9588508 splice site probably benign
R0848:Abca13 UTSW 11 9682011 nonsense probably null
R0883:Abca13 UTSW 11 9291238 nonsense probably null
R0892:Abca13 UTSW 11 9298305 missense probably benign 0.00
R0904:Abca13 UTSW 11 9298740 missense probably benign 0.22
R0968:Abca13 UTSW 11 9298016 missense probably benign 0.00
R1187:Abca13 UTSW 11 9528981 missense probably benign 0.00
R1299:Abca13 UTSW 11 9294821 missense possibly damaging 0.94
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1323:Abca13 UTSW 11 9290937 missense possibly damaging 0.86
R1368:Abca13 UTSW 11 9291836 missense probably benign
R1387:Abca13 UTSW 11 9682085 nonsense probably null
R1436:Abca13 UTSW 11 9292646 missense probably damaging 0.99
R1449:Abca13 UTSW 11 9298580 missense probably damaging 1.00
R1450:Abca13 UTSW 11 9430531 splice site probably benign
R1462:Abca13 UTSW 11 9483924 splice site probably benign
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1465:Abca13 UTSW 11 9399303 missense probably damaging 1.00
R1466:Abca13 UTSW 11 9570536 splice site probably benign
R1494:Abca13 UTSW 11 9466429 nonsense probably null
R1559:Abca13 UTSW 11 9399180 missense probably null 1.00
R1564:Abca13 UTSW 11 9434316 nonsense probably null
R1698:Abca13 UTSW 11 9314507 missense probably benign 0.13
R1728:Abca13 UTSW 11 9249680 missense probably benign 0.02
R1734:Abca13 UTSW 11 9585460 missense probably benign 0.03
R1781:Abca13 UTSW 11 9269194 missense probably damaging 1.00
R1782:Abca13 UTSW 11 9297971 missense probably benign 0.36
R1807:Abca13 UTSW 11 9291755 missense probably damaging 0.98
R1830:Abca13 UTSW 11 9290350 missense probably benign 0.04
R1869:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1870:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1871:Abca13 UTSW 11 9292134 missense probably benign 0.19
R1903:Abca13 UTSW 11 9466411 missense probably benign 0.13
R1916:Abca13 UTSW 11 9534456 missense probably damaging 1.00
R1936:Abca13 UTSW 11 9293595 missense probably benign 0.13
R1976:Abca13 UTSW 11 9397815 missense probably damaging 1.00
R2001:Abca13 UTSW 11 9273967 missense probably benign 0.01
R2007:Abca13 UTSW 11 9191987 missense probably benign 0.19
R2016:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2017:Abca13 UTSW 11 9290619 missense probably damaging 1.00
R2034:Abca13 UTSW 11 9292628 missense possibly damaging 0.83
R2051:Abca13 UTSW 11 9328098 missense probably benign 0.04
R2075:Abca13 UTSW 11 9522382 missense probably damaging 1.00
R2118:Abca13 UTSW 11 9309013 splice site probably benign
R2120:Abca13 UTSW 11 9309013 splice site probably benign
R2124:Abca13 UTSW 11 9309013 splice site probably benign
R2148:Abca13 UTSW 11 9615764 missense probably damaging 1.00
R2149:Abca13 UTSW 11 9267508 missense possibly damaging 0.68
R2157:Abca13 UTSW 11 9577170 missense probably damaging 0.97
R2167:Abca13 UTSW 11 9288532 missense probably benign 0.19
R2261:Abca13 UTSW 11 9292288 missense probably benign
R2263:Abca13 UTSW 11 9274702 missense probably benign 0.04
R2281:Abca13 UTSW 11 9328136 missense probably damaging 0.98
R2340:Abca13 UTSW 11 9399165 missense probably damaging 0.99
R2357:Abca13 UTSW 11 9297336 missense probably damaging 1.00
R2370:Abca13 UTSW 11 9256185 missense possibly damaging 0.85
R2384:Abca13 UTSW 11 9267450 splice site probably benign
R2393:Abca13 UTSW 11 9275057 nonsense probably null
R2432:Abca13 UTSW 11 9451333 splice site probably benign
R2446:Abca13 UTSW 11 9275101 missense probably benign
R2568:Abca13 UTSW 11 9333310 missense probably benign 0.40
R2847:Abca13 UTSW 11 9294584 missense possibly damaging 0.59
R2860:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2861:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2862:Abca13 UTSW 11 9309057 missense probably damaging 0.99
R2877:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R2878:Abca13 UTSW 11 9291889 missense possibly damaging 0.91
R3748:Abca13 UTSW 11 9316119 splice site probably benign
R3789:Abca13 UTSW 11 9510668 missense probably damaging 0.97
R3933:Abca13 UTSW 11 9354856 missense probably damaging 1.00
R3981:Abca13 UTSW 11 9532407 missense probably benign
R4002:Abca13 UTSW 11 9585415 missense probably benign 0.00
R4010:Abca13 UTSW 11 9622013 splice site probably benign
R4011:Abca13 UTSW 11 9622013 splice site probably benign
R4127:Abca13 UTSW 11 9191973 missense probably benign 0.00
R4214:Abca13 UTSW 11 9293877 missense probably damaging 0.96
R4236:Abca13 UTSW 11 9256205 missense probably damaging 1.00
R4237:Abca13 UTSW 11 9434188 missense probably benign 0.01
R4359:Abca13 UTSW 11 9297629 missense probably benign 0.02
R4378:Abca13 UTSW 11 9293644 missense probably benign 0.00
R4389:Abca13 UTSW 11 9297878 missense probably damaging 0.98
R4392:Abca13 UTSW 11 9309034 missense possibly damaging 0.94
R4623:Abca13 UTSW 11 9309130 missense probably damaging 1.00
R4684:Abca13 UTSW 11 9434193 nonsense probably null
R4691:Abca13 UTSW 11 9434195 missense probably damaging 1.00
R4700:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4701:Abca13 UTSW 11 9292306 missense possibly damaging 0.59
R4704:Abca13 UTSW 11 9276990 missense possibly damaging 0.94
R4751:Abca13 UTSW 11 9277973 critical splice donor site probably null
R4772:Abca13 UTSW 11 9315339 splice site probably null
R4782:Abca13 UTSW 11 9328096 missense probably damaging 0.96
R4801:Abca13 UTSW 11 9522341 missense possibly damaging 0.94
R4819:Abca13 UTSW 11 9290421 missense possibly damaging 0.88
R4831:Abca13 UTSW 11 9542077 nonsense probably null
R4851:Abca13 UTSW 11 9483890 missense probably benign 0.02
R4857:Abca13 UTSW 11 9294143 missense probably benign 0.22
R4869:Abca13 UTSW 11 9315434 splice site probably null
R4982:Abca13 UTSW 11 9292348 missense possibly damaging 0.58
R5031:Abca13 UTSW 11 9297678 missense probably damaging 0.99
R5044:Abca13 UTSW 11 9373323 missense possibly damaging 0.80
R5092:Abca13 UTSW 11 9258535 missense probably damaging 1.00
R5155:Abca13 UTSW 11 9532447 missense probably damaging 0.98
R5173:Abca13 UTSW 11 9682032 frame shift probably null
R5180:Abca13 UTSW 11 9466510 missense probably benign 0.01
R5244:Abca13 UTSW 11 9275081 missense probably benign 0.28
R5257:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5258:Abca13 UTSW 11 9249684 missense possibly damaging 0.94
R5299:Abca13 UTSW 11 9431861 missense probably damaging 1.00
R5363:Abca13 UTSW 11 9277035 missense possibly damaging 0.75
R5365:Abca13 UTSW 11 9628629 missense probably damaging 1.00
R5419:Abca13 UTSW 11 9193533 critical splice donor site probably null
R5426:Abca13 UTSW 11 9290722 missense probably damaging 1.00
R5468:Abca13 UTSW 11 9294062 missense probably damaging 1.00
R5477:Abca13 UTSW 11 9301298 missense possibly damaging 0.49
R5541:Abca13 UTSW 11 9291545 missense probably benign 0.00
R5553:Abca13 UTSW 11 9328158 missense probably damaging 1.00
R5556:Abca13 UTSW 11 9258546 missense possibly damaging 0.91
R5566:Abca13 UTSW 11 9294615 nonsense probably null
R5582:Abca13 UTSW 11 9636639 splice site probably null
R5604:Abca13 UTSW 11 9566279 missense probably damaging 0.97
R5609:Abca13 UTSW 11 9403874 missense probably benign 0.01
R5617:Abca13 UTSW 11 9277891 missense probably benign 0.00
R5693:Abca13 UTSW 11 9316233 missense probably benign 0.29
R5707:Abca13 UTSW 11 9510620 missense probably damaging 1.00
R5725:Abca13 UTSW 11 9577181 missense probably benign 0.00
R5728:Abca13 UTSW 11 9570576 missense probably damaging 1.00
R5738:Abca13 UTSW 11 9621917 missense probably damaging 1.00
R5758:Abca13 UTSW 11 9314536 missense probably damaging 0.97
R5762:Abca13 UTSW 11 9581665 missense probably damaging 1.00
R5771:Abca13 UTSW 11 9291411 missense probably damaging 1.00
R5809:Abca13 UTSW 11 9293692 missense probably damaging 1.00
R5826:Abca13 UTSW 11 9682056 missense probably damaging 0.99
R5831:Abca13 UTSW 11 9567777 nonsense probably null
R5834:Abca13 UTSW 11 9277974 critical splice donor site probably null
R5902:Abca13 UTSW 11 9297177 missense probably damaging 1.00
R5933:Abca13 UTSW 11 9249658 missense possibly damaging 0.63
R5945:Abca13 UTSW 11 9293398 missense probably benign 0.04
R5969:Abca13 UTSW 11 9292214 nonsense probably null
R5985:Abca13 UTSW 11 9291628 missense probably benign 0.02
R5998:Abca13 UTSW 11 9567708 missense probably damaging 0.97
R6021:Abca13 UTSW 11 9290465 nonsense probably null
R6022:Abca13 UTSW 11 9290759 missense probably damaging 1.00
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6032:Abca13 UTSW 11 9297752 missense possibly damaging 0.52
R6105:Abca13 UTSW 11 9397812 missense probably damaging 1.00
R6153:Abca13 UTSW 11 9301259 critical splice acceptor site probably null
R6162:Abca13 UTSW 11 9309047 missense probably damaging 1.00
R6187:Abca13 UTSW 11 9309085 missense probably damaging 1.00
R6247:Abca13 UTSW 11 9403874 missense probably benign 0.01
R6329:Abca13 UTSW 11 9277937 missense probably damaging 1.00
R6352:Abca13 UTSW 11 9309139 splice site probably null
R6367:Abca13 UTSW 11 9216248 missense possibly damaging 0.85
R6423:Abca13 UTSW 11 9298778 missense probably benign 0.01
R6424:Abca13 UTSW 11 9510542 missense probably benign
R6456:Abca13 UTSW 11 9290474 missense possibly damaging 0.94
R6490:Abca13 UTSW 11 9298661 missense probably benign 0.00
R6547:Abca13 UTSW 11 9274757 missense probably benign 0.04
R6594:Abca13 UTSW 11 9294632 missense possibly damaging 0.52
R6604:Abca13 UTSW 11 9378384 missense probably damaging 1.00
R6614:Abca13 UTSW 11 9294371 missense probably benign 0.04
R6736:Abca13 UTSW 11 9465058 missense probably damaging 1.00
R6742:Abca13 UTSW 11 9328168 missense probably damaging 1.00
R6791:Abca13 UTSW 11 9378504 missense probably damaging 1.00
R6834:Abca13 UTSW 11 9275110 missense possibly damaging 0.48
R6936:Abca13 UTSW 11 9298568 missense probably damaging 0.96
R6955:Abca13 UTSW 11 9294307 missense probably benign 0.28
X0013:Abca13 UTSW 11 9273899 missense probably benign 0.02
X0057:Abca13 UTSW 11 9294744 missense probably damaging 0.96
X0066:Abca13 UTSW 11 9267565 missense probably damaging 0.96
Z1088:Abca13 UTSW 11 9294687 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACATATGAGTGGTGGCAATAGC -3'
(R):5'- ACTCCATGTAGCCTAAGTGGG -3'

Sequencing Primer
(F):5'- GGCAATAGCTGTGCTTGAAG -3'
(R):5'- TGGGAACACAGACTAACCATC -3'
Posted On2016-02-04