Incidental Mutation 'R1508:Trim56'
ID168058
Institutional Source Beutler Lab
Gene Symbol Trim56
Ensembl Gene ENSMUSG00000043279
Gene Nametripartite motif-containing 56
SynonymsRNF109, A130009K11Rik, LOC384309
MMRRC Submission 040869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1508 (G1)
Quality Score150
Status Not validated
Chromosome5
Chromosomal Location137105644-137116209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137113937 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 242 (A242T)
Ref Sequence ENSEMBL: ENSMUSP00000058109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054384] [ENSMUST00000152207]
Predicted Effect probably benign
Transcript: ENSMUST00000054384
AA Change: A242T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058109
Gene: ENSMUSG00000043279
AA Change: A242T

DomainStartEndE-ValueType
RING 21 59 9.09e-8 SMART
low complexity region 118 133 N/A INTRINSIC
Pfam:zf-B_box 164 205 1.9e-7 PFAM
coiled coil region 257 291 N/A INTRINSIC
low complexity region 302 309 N/A INTRINSIC
low complexity region 381 399 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152207
SMART Domains Protein: ENSMUSP00000117874
Gene: ENSMUSG00000043279

DomainStartEndE-ValueType
RING 21 59 9.09e-8 SMART
low complexity region 118 133 N/A INTRINSIC
Pfam:zf-B_box 164 205 2.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,581,921 E401G probably benign Het
Agbl4 T C 4: 111,656,398 I447T probably benign Het
Alpk2 C A 18: 65,349,305 G544V probably damaging Het
Apob T C 12: 8,011,481 I3321T possibly damaging Het
Ccdc47 C T 11: 106,202,416 D70N probably damaging Het
Ceacam13 T A 7: 18,011,071 V22D possibly damaging Het
Cep76 A G 18: 67,623,288 M491T probably damaging Het
Clec4a3 A T 6: 122,967,508 N171I probably benign Het
Col20a1 A G 2: 180,992,577 I112V probably damaging Het
Col4a4 A T 1: 82,455,836 L1462H unknown Het
Cubn A G 2: 13,427,105 F1226L probably benign Het
Cyp4a31 T A 4: 115,565,053 I77K possibly damaging Het
Dcaf1 A T 9: 106,854,177 T618S probably damaging Het
Echdc3 A T 2: 6,206,420 S129T probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat1 T C 8: 45,026,862 F2982L probably benign Het
Gm11639 T C 11: 104,710,677 V272A probably benign Het
Gm9476 A T 10: 100,306,838 noncoding transcript Het
Golga1 A G 2: 39,023,249 M542T probably benign Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
Jazf1 G A 6: 52,812,181 H103Y probably damaging Het
Klhl12 T C 1: 134,488,974 V478A possibly damaging Het
Lpcat2b A T 5: 107,433,464 T220S probably damaging Het
Myocd C T 11: 65,184,516 C594Y probably damaging Het
Nf1 A G 11: 79,440,909 E700G probably damaging Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr625-ps1 T C 7: 103,683,471 V251A possibly damaging Het
Papln A G 12: 83,782,916 Q937R probably damaging Het
Pex14 T C 4: 148,967,572 R147G probably damaging Het
Plppr3 A T 10: 79,867,540 Y37N probably damaging Het
Polr1b A G 2: 129,113,734 T522A probably benign Het
Ppp3cb T C 14: 20,524,424 N201S probably damaging Het
Prf1 A G 10: 61,303,550 D429G probably damaging Het
Ptprn2 T C 12: 117,184,722 S701P probably damaging Het
Rp1l1 C T 14: 64,030,892 T1309I possibly damaging Het
Sipa1l1 T A 12: 82,440,893 M1647K probably damaging Het
Skint11 T C 4: 114,231,766 probably null Het
Slc8a2 T C 7: 16,140,597 Y257H probably benign Het
Slfn1 T A 11: 83,121,355 I99N probably damaging Het
Slit2 A G 5: 48,192,249 T282A probably damaging Het
Slit3 A T 11: 35,570,621 D228V probably damaging Het
Specc1l A G 10: 75,307,238 N1031S probably benign Het
Supt6 A G 11: 78,216,203 probably null Het
Tdrd1 G A 19: 56,851,358 E617K probably damaging Het
Tex15 C G 8: 33,576,852 F2103L probably damaging Het
Trim21 T A 7: 102,559,576 Q312L possibly damaging Het
Usp4 T C 9: 108,372,674 V467A probably benign Het
Vmn2r65 T A 7: 84,940,678 I677L probably benign Het
Vstm4 T C 14: 32,863,554 V26A probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfat T A 15: 68,178,751 K807I probably damaging Het
Other mutations in Trim56
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Trim56 APN 5 137114500 missense possibly damaging 0.95
IGL02604:Trim56 APN 5 137113076 missense probably damaging 0.98
IGL02653:Trim56 APN 5 137112906 missense probably damaging 1.00
IGL03069:Trim56 APN 5 137113762 missense probably damaging 0.99
R0711:Trim56 UTSW 5 137112992 missense probably benign 0.00
R1167:Trim56 UTSW 5 137112520 missense probably damaging 0.98
R1470:Trim56 UTSW 5 137113163 missense probably damaging 0.99
R1470:Trim56 UTSW 5 137113163 missense probably damaging 0.99
R1791:Trim56 UTSW 5 137114398 missense probably damaging 1.00
R2484:Trim56 UTSW 5 137112674 missense possibly damaging 0.95
R4274:Trim56 UTSW 5 137113687 missense probably damaging 1.00
R4579:Trim56 UTSW 5 137114064 missense possibly damaging 0.60
R4766:Trim56 UTSW 5 137112725 missense probably benign 0.07
R4932:Trim56 UTSW 5 137114489 missense probably damaging 1.00
R5117:Trim56 UTSW 5 137113978 missense probably benign 0.13
R6444:Trim56 UTSW 5 137112616 missense probably damaging 0.99
R6747:Trim56 UTSW 5 137114521 missense probably damaging 1.00
R6962:Trim56 UTSW 5 137112647 missense probably damaging 0.97
X0019:Trim56 UTSW 5 137114210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGATTGCTCCCTCCAGCGAAAG -3'
(R):5'- AGTTGCTCTGCAAGGATTGCCG -3'

Sequencing Primer
(F):5'- GAAAGGATCTCGGCCTCTAGAC -3'
(R):5'- CAAGGATTGCCGCCTGG -3'
Posted On2014-04-13